ID: 1076736777

View in Genome Browser
Species Human (GRCh38)
Location 10:132462528-132462550
Sequence CTGGAGACCCAGGTAAAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076736777_1076736780 -6 Left 1076736777 10:132462528-132462550 CCTTGTTTTACCTGGGTCTCCAG No data
Right 1076736780 10:132462545-132462567 CTCCAGACCGCAAGGACACTTGG No data
1076736777_1076736784 12 Left 1076736777 10:132462528-132462550 CCTTGTTTTACCTGGGTCTCCAG No data
Right 1076736784 10:132462563-132462585 CTTGGCTGTGAGCAGGACTCCGG No data
1076736777_1076736783 5 Left 1076736777 10:132462528-132462550 CCTTGTTTTACCTGGGTCTCCAG No data
Right 1076736783 10:132462556-132462578 AAGGACACTTGGCTGTGAGCAGG No data
1076736777_1076736785 13 Left 1076736777 10:132462528-132462550 CCTTGTTTTACCTGGGTCTCCAG No data
Right 1076736785 10:132462564-132462586 TTGGCTGTGAGCAGGACTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076736777 Original CRISPR CTGGAGACCCAGGTAAAACA AGG (reversed) Intergenic
No off target data available for this crispr