ID: 1076737255

View in Genome Browser
Species Human (GRCh38)
Location 10:132464432-132464454
Sequence GGGGAGCCAACCGCCCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076737245_1076737255 12 Left 1076737245 10:132464397-132464419 CCAGGAGGAGGCCATGCTTGCCT No data
Right 1076737255 10:132464432-132464454 GGGGAGCCAACCGCCCTTCCTGG No data
1076737244_1076737255 20 Left 1076737244 10:132464389-132464411 CCAGGCTTCCAGGAGGAGGCCAT No data
Right 1076737255 10:132464432-132464454 GGGGAGCCAACCGCCCTTCCTGG No data
1076737241_1076737255 25 Left 1076737241 10:132464384-132464406 CCGGCCCAGGCTTCCAGGAGGAG No data
Right 1076737255 10:132464432-132464454 GGGGAGCCAACCGCCCTTCCTGG No data
1076737247_1076737255 1 Left 1076737247 10:132464408-132464430 CCATGCTTGCCTGCCCTTGGCCA No data
Right 1076737255 10:132464432-132464454 GGGGAGCCAACCGCCCTTCCTGG No data
1076737243_1076737255 21 Left 1076737243 10:132464388-132464410 CCCAGGCTTCCAGGAGGAGGCCA No data
Right 1076737255 10:132464432-132464454 GGGGAGCCAACCGCCCTTCCTGG No data
1076737251_1076737255 -8 Left 1076737251 10:132464417-132464439 CCTGCCCTTGGCCAAGGGGAGCC No data
Right 1076737255 10:132464432-132464454 GGGGAGCCAACCGCCCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076737255 Original CRISPR GGGGAGCCAACCGCCCTTCC TGG Intergenic
No off target data available for this crispr