ID: 1076738449

View in Genome Browser
Species Human (GRCh38)
Location 10:132468884-132468906
Sequence CAGCACTGGCCCCTTGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076738443_1076738449 2 Left 1076738443 10:132468859-132468881 CCACCAGGGCCTCAGGAATCTCT No data
Right 1076738449 10:132468884-132468906 CAGCACTGGCCCCTTGCCCTGGG No data
1076738446_1076738449 -7 Left 1076738446 10:132468868-132468890 CCTCAGGAATCTCTGGCAGCACT No data
Right 1076738449 10:132468884-132468906 CAGCACTGGCCCCTTGCCCTGGG No data
1076738441_1076738449 6 Left 1076738441 10:132468855-132468877 CCACCCACCAGGGCCTCAGGAAT No data
Right 1076738449 10:132468884-132468906 CAGCACTGGCCCCTTGCCCTGGG No data
1076738440_1076738449 7 Left 1076738440 10:132468854-132468876 CCCACCCACCAGGGCCTCAGGAA No data
Right 1076738449 10:132468884-132468906 CAGCACTGGCCCCTTGCCCTGGG No data
1076738445_1076738449 -1 Left 1076738445 10:132468862-132468884 CCAGGGCCTCAGGAATCTCTGGC No data
Right 1076738449 10:132468884-132468906 CAGCACTGGCCCCTTGCCCTGGG No data
1076738442_1076738449 3 Left 1076738442 10:132468858-132468880 CCCACCAGGGCCTCAGGAATCTC No data
Right 1076738449 10:132468884-132468906 CAGCACTGGCCCCTTGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076738449 Original CRISPR CAGCACTGGCCCCTTGCCCT GGG Intergenic
No off target data available for this crispr