ID: 1076739932

View in Genome Browser
Species Human (GRCh38)
Location 10:132478089-132478111
Sequence CAGGCTGAGGAGAGGGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076739918_1076739932 29 Left 1076739918 10:132478037-132478059 CCAGAGTGTGGGCCAAGAACCAC No data
Right 1076739932 10:132478089-132478111 CAGGCTGAGGAGAGGGGCCCTGG No data
1076739922_1076739932 10 Left 1076739922 10:132478056-132478078 CCACAGCCATGGAGTCAGGAGCA No data
Right 1076739932 10:132478089-132478111 CAGGCTGAGGAGAGGGGCCCTGG No data
1076739924_1076739932 4 Left 1076739924 10:132478062-132478084 CCATGGAGTCAGGAGCATGTGGG No data
Right 1076739932 10:132478089-132478111 CAGGCTGAGGAGAGGGGCCCTGG No data
1076739917_1076739932 30 Left 1076739917 10:132478036-132478058 CCCAGAGTGTGGGCCAAGAACCA No data
Right 1076739932 10:132478089-132478111 CAGGCTGAGGAGAGGGGCCCTGG No data
1076739920_1076739932 17 Left 1076739920 10:132478049-132478071 CCAAGAACCACAGCCATGGAGTC No data
Right 1076739932 10:132478089-132478111 CAGGCTGAGGAGAGGGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076739932 Original CRISPR CAGGCTGAGGAGAGGGGCCC TGG Intergenic
No off target data available for this crispr