ID: 1076740068

View in Genome Browser
Species Human (GRCh38)
Location 10:132478525-132478547
Sequence CCCCGGGCCCAGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076740068_1076740082 30 Left 1076740068 10:132478525-132478547 CCCTCTGCCCTCTGGGCCCGGGG No data
Right 1076740082 10:132478578-132478600 GGCCTGCAAACCCCAGGAAGTGG No data
1076740068_1076740073 -10 Left 1076740068 10:132478525-132478547 CCCTCTGCCCTCTGGGCCCGGGG No data
Right 1076740073 10:132478538-132478560 GGGCCCGGGGATATTGAAGCTGG No data
1076740068_1076740074 -9 Left 1076740068 10:132478525-132478547 CCCTCTGCCCTCTGGGCCCGGGG No data
Right 1076740074 10:132478539-132478561 GGCCCGGGGATATTGAAGCTGGG No data
1076740068_1076740080 24 Left 1076740068 10:132478525-132478547 CCCTCTGCCCTCTGGGCCCGGGG No data
Right 1076740080 10:132478572-132478594 TGCCGAGGCCTGCAAACCCCAGG No data
1076740068_1076740077 -3 Left 1076740068 10:132478525-132478547 CCCTCTGCCCTCTGGGCCCGGGG No data
Right 1076740077 10:132478545-132478567 GGGATATTGAAGCTGGGCAAAGG No data
1076740068_1076740078 9 Left 1076740068 10:132478525-132478547 CCCTCTGCCCTCTGGGCCCGGGG No data
Right 1076740078 10:132478557-132478579 CTGGGCAAAGGCCGCTGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076740068 Original CRISPR CCCCGGGCCCAGAGGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr