ID: 1076740212

View in Genome Browser
Species Human (GRCh38)
Location 10:132479149-132479171
Sequence GTGGTCACCCGGACCTAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076740212_1076740221 20 Left 1076740212 10:132479149-132479171 CCATCCTAGGTCCGGGTGACCAC No data
Right 1076740221 10:132479192-132479214 CCTAACCCATGACATCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076740212 Original CRISPR GTGGTCACCCGGACCTAGGA TGG (reversed) Intergenic
No off target data available for this crispr