ID: 1076741197

View in Genome Browser
Species Human (GRCh38)
Location 10:132486584-132486606
Sequence GAGAGCTCTGTGTGGACTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076741197_1076741205 15 Left 1076741197 10:132486584-132486606 CCCCGAGTCCACACAGAGCTCTC No data
Right 1076741205 10:132486622-132486644 GAGTGCAAACTGGCACAGCCAGG No data
1076741197_1076741204 5 Left 1076741197 10:132486584-132486606 CCCCGAGTCCACACAGAGCTCTC No data
Right 1076741204 10:132486612-132486634 CCACTGCTGAGAGTGCAAACTGG No data
1076741197_1076741206 19 Left 1076741197 10:132486584-132486606 CCCCGAGTCCACACAGAGCTCTC No data
Right 1076741206 10:132486626-132486648 GCAAACTGGCACAGCCAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076741197 Original CRISPR GAGAGCTCTGTGTGGACTCG GGG (reversed) Intergenic
No off target data available for this crispr