ID: 1076742322

View in Genome Browser
Species Human (GRCh38)
Location 10:132492735-132492757
Sequence CAGTGGGAACAGCTGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076742322_1076742329 10 Left 1076742322 10:132492735-132492757 CCTGGCTCCAGCTGTTCCCACTG No data
Right 1076742329 10:132492768-132492790 GCCTCGTTCTCGCTGTTCTCTGG No data
1076742322_1076742331 17 Left 1076742322 10:132492735-132492757 CCTGGCTCCAGCTGTTCCCACTG No data
Right 1076742331 10:132492775-132492797 TCTCGCTGTTCTCTGGCTGCTGG No data
1076742322_1076742332 18 Left 1076742322 10:132492735-132492757 CCTGGCTCCAGCTGTTCCCACTG No data
Right 1076742332 10:132492776-132492798 CTCGCTGTTCTCTGGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076742322 Original CRISPR CAGTGGGAACAGCTGGAGCC AGG (reversed) Intergenic
No off target data available for this crispr