ID: 1076742403

View in Genome Browser
Species Human (GRCh38)
Location 10:132493227-132493249
Sequence CTGTGTGAGATGGAGACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076742403_1076742407 2 Left 1076742403 10:132493227-132493249 CCCTCAGTCTCCATCTCACACAG No data
Right 1076742407 10:132493252-132493274 GCTCTGTGAGCTCTTTGTGCGGG No data
1076742403_1076742408 3 Left 1076742403 10:132493227-132493249 CCCTCAGTCTCCATCTCACACAG No data
Right 1076742408 10:132493253-132493275 CTCTGTGAGCTCTTTGTGCGGGG No data
1076742403_1076742406 1 Left 1076742403 10:132493227-132493249 CCCTCAGTCTCCATCTCACACAG No data
Right 1076742406 10:132493251-132493273 TGCTCTGTGAGCTCTTTGTGCGG No data
1076742403_1076742409 4 Left 1076742403 10:132493227-132493249 CCCTCAGTCTCCATCTCACACAG No data
Right 1076742409 10:132493254-132493276 TCTGTGAGCTCTTTGTGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076742403 Original CRISPR CTGTGTGAGATGGAGACTGA GGG (reversed) Intergenic
No off target data available for this crispr