ID: 1076749296

View in Genome Browser
Species Human (GRCh38)
Location 10:132534334-132534356
Sequence CCTGACATATAGACTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076749292_1076749296 4 Left 1076749292 10:132534307-132534329 CCAAATGGAGTCACTGGTATTAA No data
Right 1076749296 10:132534334-132534356 CCTGACATATAGACTGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076749296 Original CRISPR CCTGACATATAGACTGTGGA AGG Intergenic
No off target data available for this crispr