ID: 1076749804

View in Genome Browser
Species Human (GRCh38)
Location 10:132537120-132537142
Sequence GGCGCGTCCACCCGGCTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076749804_1076749812 19 Left 1076749804 10:132537120-132537142 CCAGGGAGCCGGGTGGACGCGCC No data
Right 1076749812 10:132537162-132537184 GCTCCGTCTGCGCGGAGAGCCGG No data
1076749804_1076749815 29 Left 1076749804 10:132537120-132537142 CCAGGGAGCCGGGTGGACGCGCC No data
Right 1076749815 10:132537172-132537194 CGCGGAGAGCCGGGCGCGCGTGG No data
1076749804_1076749810 11 Left 1076749804 10:132537120-132537142 CCAGGGAGCCGGGTGGACGCGCC No data
Right 1076749810 10:132537154-132537176 CGGTCCACGCTCCGTCTGCGCGG No data
1076749804_1076749808 -9 Left 1076749804 10:132537120-132537142 CCAGGGAGCCGGGTGGACGCGCC No data
Right 1076749808 10:132537134-132537156 GGACGCGCCGGGAAGCTGCACGG No data
1076749804_1076749813 20 Left 1076749804 10:132537120-132537142 CCAGGGAGCCGGGTGGACGCGCC No data
Right 1076749813 10:132537163-132537185 CTCCGTCTGCGCGGAGAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076749804 Original CRISPR GGCGCGTCCACCCGGCTCCC TGG (reversed) Intergenic
No off target data available for this crispr