ID: 1076749809

View in Genome Browser
Species Human (GRCh38)
Location 10:132537141-132537163
Sequence GCGTGGACCGTGCAGCTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076749809_1076749818 23 Left 1076749809 10:132537141-132537163 CCGGGAAGCTGCACGGTCCACGC No data
Right 1076749818 10:132537187-132537209 GCGCGTGGCCCGGCCCCTGCAGG No data
1076749809_1076749816 13 Left 1076749809 10:132537141-132537163 CCGGGAAGCTGCACGGTCCACGC No data
Right 1076749816 10:132537177-132537199 AGAGCCGGGCGCGCGTGGCCCGG No data
1076749809_1076749813 -1 Left 1076749809 10:132537141-132537163 CCGGGAAGCTGCACGGTCCACGC No data
Right 1076749813 10:132537163-132537185 CTCCGTCTGCGCGGAGAGCCGGG No data
1076749809_1076749810 -10 Left 1076749809 10:132537141-132537163 CCGGGAAGCTGCACGGTCCACGC No data
Right 1076749810 10:132537154-132537176 CGGTCCACGCTCCGTCTGCGCGG No data
1076749809_1076749815 8 Left 1076749809 10:132537141-132537163 CCGGGAAGCTGCACGGTCCACGC No data
Right 1076749815 10:132537172-132537194 CGCGGAGAGCCGGGCGCGCGTGG No data
1076749809_1076749812 -2 Left 1076749809 10:132537141-132537163 CCGGGAAGCTGCACGGTCCACGC No data
Right 1076749812 10:132537162-132537184 GCTCCGTCTGCGCGGAGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076749809 Original CRISPR GCGTGGACCGTGCAGCTTCC CGG (reversed) Intergenic
No off target data available for this crispr