ID: 1076749811

View in Genome Browser
Species Human (GRCh38)
Location 10:132537158-132537180
Sequence CTCTCCGCGCAGACGGAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076749811_1076749818 6 Left 1076749811 10:132537158-132537180 CCACGCTCCGTCTGCGCGGAGAG No data
Right 1076749818 10:132537187-132537209 GCGCGTGGCCCGGCCCCTGCAGG No data
1076749811_1076749815 -9 Left 1076749811 10:132537158-132537180 CCACGCTCCGTCTGCGCGGAGAG No data
Right 1076749815 10:132537172-132537194 CGCGGAGAGCCGGGCGCGCGTGG No data
1076749811_1076749816 -4 Left 1076749811 10:132537158-132537180 CCACGCTCCGTCTGCGCGGAGAG No data
Right 1076749816 10:132537177-132537199 AGAGCCGGGCGCGCGTGGCCCGG No data
1076749811_1076749824 26 Left 1076749811 10:132537158-132537180 CCACGCTCCGTCTGCGCGGAGAG No data
Right 1076749824 10:132537207-132537229 AGGCGCGACTGCCGCCGCCCCGG No data
1076749811_1076749826 30 Left 1076749811 10:132537158-132537180 CCACGCTCCGTCTGCGCGGAGAG No data
Right 1076749826 10:132537211-132537233 GCGACTGCCGCCGCCCCGGTGGG No data
1076749811_1076749825 29 Left 1076749811 10:132537158-132537180 CCACGCTCCGTCTGCGCGGAGAG No data
Right 1076749825 10:132537210-132537232 CGCGACTGCCGCCGCCCCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076749811 Original CRISPR CTCTCCGCGCAGACGGAGCG TGG (reversed) Intergenic
No off target data available for this crispr