ID: 1076749813

View in Genome Browser
Species Human (GRCh38)
Location 10:132537163-132537185
Sequence CTCCGTCTGCGCGGAGAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076749809_1076749813 -1 Left 1076749809 10:132537141-132537163 CCGGGAAGCTGCACGGTCCACGC No data
Right 1076749813 10:132537163-132537185 CTCCGTCTGCGCGGAGAGCCGGG No data
1076749804_1076749813 20 Left 1076749804 10:132537120-132537142 CCAGGGAGCCGGGTGGACGCGCC No data
Right 1076749813 10:132537163-132537185 CTCCGTCTGCGCGGAGAGCCGGG No data
1076749807_1076749813 12 Left 1076749807 10:132537128-132537150 CCGGGTGGACGCGCCGGGAAGCT No data
Right 1076749813 10:132537163-132537185 CTCCGTCTGCGCGGAGAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076749813 Original CRISPR CTCCGTCTGCGCGGAGAGCC GGG Intergenic
No off target data available for this crispr