ID: 1076749815

View in Genome Browser
Species Human (GRCh38)
Location 10:132537172-132537194
Sequence CGCGGAGAGCCGGGCGCGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076749809_1076749815 8 Left 1076749809 10:132537141-132537163 CCGGGAAGCTGCACGGTCCACGC No data
Right 1076749815 10:132537172-132537194 CGCGGAGAGCCGGGCGCGCGTGG No data
1076749811_1076749815 -9 Left 1076749811 10:132537158-132537180 CCACGCTCCGTCTGCGCGGAGAG No data
Right 1076749815 10:132537172-132537194 CGCGGAGAGCCGGGCGCGCGTGG No data
1076749807_1076749815 21 Left 1076749807 10:132537128-132537150 CCGGGTGGACGCGCCGGGAAGCT No data
Right 1076749815 10:132537172-132537194 CGCGGAGAGCCGGGCGCGCGTGG No data
1076749804_1076749815 29 Left 1076749804 10:132537120-132537142 CCAGGGAGCCGGGTGGACGCGCC No data
Right 1076749815 10:132537172-132537194 CGCGGAGAGCCGGGCGCGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076749815 Original CRISPR CGCGGAGAGCCGGGCGCGCG TGG Intergenic
No off target data available for this crispr