ID: 1076749816

View in Genome Browser
Species Human (GRCh38)
Location 10:132537177-132537199
Sequence AGAGCCGGGCGCGCGTGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076749811_1076749816 -4 Left 1076749811 10:132537158-132537180 CCACGCTCCGTCTGCGCGGAGAG No data
Right 1076749816 10:132537177-132537199 AGAGCCGGGCGCGCGTGGCCCGG No data
1076749807_1076749816 26 Left 1076749807 10:132537128-132537150 CCGGGTGGACGCGCCGGGAAGCT No data
Right 1076749816 10:132537177-132537199 AGAGCCGGGCGCGCGTGGCCCGG No data
1076749809_1076749816 13 Left 1076749809 10:132537141-132537163 CCGGGAAGCTGCACGGTCCACGC No data
Right 1076749816 10:132537177-132537199 AGAGCCGGGCGCGCGTGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076749816 Original CRISPR AGAGCCGGGCGCGCGTGGCC CGG Intergenic
No off target data available for this crispr