ID: 1076749818

View in Genome Browser
Species Human (GRCh38)
Location 10:132537187-132537209
Sequence GCGCGTGGCCCGGCCCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076749809_1076749818 23 Left 1076749809 10:132537141-132537163 CCGGGAAGCTGCACGGTCCACGC No data
Right 1076749818 10:132537187-132537209 GCGCGTGGCCCGGCCCCTGCAGG No data
1076749814_1076749818 -1 Left 1076749814 10:132537165-132537187 CCGTCTGCGCGGAGAGCCGGGCG No data
Right 1076749818 10:132537187-132537209 GCGCGTGGCCCGGCCCCTGCAGG No data
1076749811_1076749818 6 Left 1076749811 10:132537158-132537180 CCACGCTCCGTCTGCGCGGAGAG No data
Right 1076749818 10:132537187-132537209 GCGCGTGGCCCGGCCCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076749818 Original CRISPR GCGCGTGGCCCGGCCCCTGC AGG Intergenic
No off target data available for this crispr