ID: 1076749824

View in Genome Browser
Species Human (GRCh38)
Location 10:132537207-132537229
Sequence AGGCGCGACTGCCGCCGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076749817_1076749824 3 Left 1076749817 10:132537181-132537203 CCGGGCGCGCGTGGCCCGGCCCC No data
Right 1076749824 10:132537207-132537229 AGGCGCGACTGCCGCCGCCCCGG No data
1076749811_1076749824 26 Left 1076749811 10:132537158-132537180 CCACGCTCCGTCTGCGCGGAGAG No data
Right 1076749824 10:132537207-132537229 AGGCGCGACTGCCGCCGCCCCGG No data
1076749814_1076749824 19 Left 1076749814 10:132537165-132537187 CCGTCTGCGCGGAGAGCCGGGCG No data
Right 1076749824 10:132537207-132537229 AGGCGCGACTGCCGCCGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076749824 Original CRISPR AGGCGCGACTGCCGCCGCCC CGG Intergenic
No off target data available for this crispr