ID: 1076749825

View in Genome Browser
Species Human (GRCh38)
Location 10:132537210-132537232
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076749817_1076749825 6 Left 1076749817 10:132537181-132537203 CCGGGCGCGCGTGGCCCGGCCCC No data
Right 1076749825 10:132537210-132537232 CGCGACTGCCGCCGCCCCGGTGG No data
1076749819_1076749825 -8 Left 1076749819 10:132537195-132537217 CCCGGCCCCTGCAGGCGCGACTG No data
Right 1076749825 10:132537210-132537232 CGCGACTGCCGCCGCCCCGGTGG No data
1076749811_1076749825 29 Left 1076749811 10:132537158-132537180 CCACGCTCCGTCTGCGCGGAGAG No data
Right 1076749825 10:132537210-132537232 CGCGACTGCCGCCGCCCCGGTGG No data
1076749814_1076749825 22 Left 1076749814 10:132537165-132537187 CCGTCTGCGCGGAGAGCCGGGCG No data
Right 1076749825 10:132537210-132537232 CGCGACTGCCGCCGCCCCGGTGG No data
1076749820_1076749825 -9 Left 1076749820 10:132537196-132537218 CCGGCCCCTGCAGGCGCGACTGC No data
Right 1076749825 10:132537210-132537232 CGCGACTGCCGCCGCCCCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076749825 Original CRISPR CGCGACTGCCGCCGCCCCGG TGG Intergenic