ID: 1076750618

View in Genome Browser
Species Human (GRCh38)
Location 10:132540749-132540771
Sequence CAGCCTGAGCACTGCCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076750618_1076750621 13 Left 1076750618 10:132540749-132540771 CCCTGCAGGCAGTGCTCAGGCTG No data
Right 1076750621 10:132540785-132540807 CTCGCCCAGTCTCACCGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076750618 Original CRISPR CAGCCTGAGCACTGCCTGCA GGG (reversed) Intronic