ID: 1076751309

View in Genome Browser
Species Human (GRCh38)
Location 10:132544807-132544829
Sequence ACACCGCCGGCCGTTCTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 18
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 16}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076751309 Original CRISPR ACACCGCCGGCCGTTCTCAA AGG (reversed) Intronic
903011361 1:20332882-20332904 ACCCCACCAGCCGTTCTCCAGGG - Exonic
924017424 1:239742605-239742627 ACACCGCCAGCCCCACTCAAGGG + Intronic
1076751309 10:132544807-132544829 ACACCGCCGGCCGTTCTCAAAGG - Intronic
1083032753 11:59608915-59608937 ACACCCCAGGTCCTTCTCAAAGG + Intronic
1083782592 11:64925912-64925934 ACACCGCTGCCCCTGCTCAAAGG + Exonic
1087114700 11:94512653-94512675 ACACTGCTGGCCGTGCTCTAGGG - Intergenic
1131060436 15:89400598-89400620 AGATCGCCGGCCTTTCCCAAAGG + Intergenic
1163692687 19:18745921-18745943 ACACCGCCGGCCCCTGTCAGTGG + Exonic
1171196096 20:23200808-23200830 ACAATGGGGGCCGTTCTCAAGGG + Intergenic
1179224539 21:39442278-39442300 AAACCGCTGGCCCTTCTCACTGG - Intronic
1183429963 22:37759495-37759517 ACCCCGCCTGCAGGTCTCAAAGG + Intronic
1185221825 22:49632928-49632950 AGACCCCAGGCCGTGCTCAATGG - Intronic
957984682 3:87558645-87558667 ACACAGCCGGCCTTTCTCTAAGG - Intergenic
978106130 4:104904080-104904102 ACACCCCCCGCCGTTCACACTGG - Intergenic
985786955 5:1901301-1901323 CCACCACCAGCCGTTCCCAAGGG + Intergenic
1004167445 6:13269479-13269501 ACACAGCTGGCCCTTGTCAATGG + Intronic
1007430762 6:41775432-41775454 ACATCGGCGGCCACTCTCAAAGG + Exonic
1057950974 9:99368879-99368901 ACACCGCAGGAAGTTTTCAAAGG + Intergenic