ID: 1076753451

View in Genome Browser
Species Human (GRCh38)
Location 10:132555251-132555273
Sequence GCCCTTCCCCAGCACGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076753451_1076753456 19 Left 1076753451 10:132555251-132555273 CCTTCACCGTGCTGGGGAAGGGC 0: 1
1: 0
2: 0
3: 15
4: 148
Right 1076753456 10:132555293-132555315 GACCAGTGAGAAGATGTCGTAGG No data
1076753451_1076753458 24 Left 1076753451 10:132555251-132555273 CCTTCACCGTGCTGGGGAAGGGC 0: 1
1: 0
2: 0
3: 15
4: 148
Right 1076753458 10:132555298-132555320 GTGAGAAGATGTCGTAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076753451 Original CRISPR GCCCTTCCCCAGCACGGTGA AGG (reversed) Intronic
900690815 1:3979196-3979218 CTCCTTCTTCAGCACGGTGAGGG - Intergenic
900897902 1:5496618-5496640 GCCCTACCCCAGCTAGATGAAGG + Intergenic
901167977 1:7233350-7233372 GCCCCATCCCAGCACAGTGATGG - Intronic
901790278 1:11650257-11650279 GCCCTGCCCCAGCTGGCTGAGGG + Intronic
903326180 1:22569840-22569862 GCCCTTCCCCAGGAGGATGGGGG - Intronic
903674614 1:25056037-25056059 TCCCTTCCCCAGCACAGTGGAGG - Intergenic
903772013 1:25770024-25770046 GCCCTTCTCCAGCCCCGTCATGG - Intronic
904915914 1:33970611-33970633 GGCCTTCCCCAGAAGGGAGATGG + Intronic
907450412 1:54542452-54542474 GCCCTTCCCCCGCGCGGGGCGGG - Intronic
912449253 1:109759283-109759305 GCCCGGCTCCTGCACGGTGATGG + Exonic
912518831 1:110231868-110231890 CCCCTTCCCTAGAAAGGTGATGG + Intronic
913082751 1:115403904-115403926 TTTCTTCCCCAGCACAGTGAAGG - Intergenic
914431596 1:147624286-147624308 GCTGTTCCCCAGGACAGTGAAGG - Exonic
914812200 1:151037178-151037200 GCCACTCCCCAGCTCGGTGGAGG + Intronic
916917717 1:169427532-169427554 GCCCTTCGCAAGCACCGGGATGG - Intronic
920351898 1:205343365-205343387 CCGCTTCCCCAGGGCGGTGACGG + Exonic
920735499 1:208529643-208529665 GCCTTTCCCCAGCTCGCTGGAGG + Intergenic
922466611 1:225849066-225849088 CCCCTTCCTCAGCAGGGTGAGGG - Intronic
922699115 1:227747936-227747958 GCCCTTCTCCAGGATGGTGATGG - Exonic
922798919 1:228355242-228355264 GACCCTCCCCAGCACCCTGAGGG - Intronic
923232192 1:231997515-231997537 GGCCTTCCTCAGCAATGTGAAGG - Intronic
1065322434 10:24521939-24521961 GGCCACCCCCAGCACGATGAGGG - Intronic
1065881934 10:30044463-30044485 ACCCTTCCCAATCACGCTGATGG + Intronic
1067091099 10:43266280-43266302 ACCCTTGCCCAGCAGGGAGAGGG + Intronic
1071495416 10:86164518-86164540 GCCCTCACCCAGCACAGTGGAGG + Intronic
1071521174 10:86332259-86332281 GGGCTGCCCCAGGACGGTGAAGG + Intronic
1072472295 10:95723869-95723891 GCCCTTTCCCAGCACAGGCACGG + Intronic
1076753451 10:132555251-132555273 GCCCTTCCCCAGCACGGTGAAGG - Intronic
1076811596 10:132889114-132889136 GCCCTCCCCCAGCACTCTGCAGG + Intronic
1076845554 10:133067916-133067938 CCCCATCCCCAGCACTGTGCTGG + Intergenic
1081591758 11:44427958-44427980 GCCCTTCCCCAATATGGCGATGG + Intergenic
1083720261 11:64600388-64600410 GCCCAGCCCCAGCACGGCCAAGG - Exonic
1083768683 11:64854486-64854508 GATCTTCCCTAGCACGGTGTTGG + Exonic
1084692251 11:70734206-70734228 GCCCTTCCAGGGCACCGTGACGG + Intronic
1086447657 11:86885283-86885305 GCCCTTTCCCGGCACTGTGATGG + Intronic
1089147840 11:116343324-116343346 GCCCTGCCCCAAGGCGGTGATGG + Intergenic
1090425262 11:126603060-126603082 ACCCCTCCCCTGCAGGGTGACGG - Intronic
1091322579 11:134662706-134662728 CCCCATCCCCAGCACAGTGGGGG + Intergenic
1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG + Intronic
1095977184 12:47947689-47947711 GCCCTGCGCCAGGACAGTGAGGG + Intergenic
1096465968 12:51848032-51848054 GAGATTCCCCAGCATGGTGACGG - Intergenic
1101333584 12:103777154-103777176 GTCCTTCCCCAGCATGGAGGAGG - Exonic
1103214528 12:119191379-119191401 GCCCATCCCCAGCATTGGGAGGG + Intronic
1104768519 12:131345899-131345921 GCCCTGCCCCAGGAGGGTGCTGG + Intergenic
1104861967 12:131928809-131928831 GCCCTTCACCCGCACGGTAGAGG - Intergenic
1105502924 13:20988480-20988502 GCCCGCCCCCAACACCGTGACGG - Exonic
1111826242 13:93271343-93271365 GCCCTCCCCCAAGACAGTGAAGG + Intronic
1112326806 13:98447015-98447037 GCCCTTACCCTGCACGGTGTTGG + Intronic
1116966836 14:51023549-51023571 GCCTTTCCCCTGCAAGGTGTTGG - Intronic
1119720568 14:76887362-76887384 GCCCTTTCCCTTCACGGTGCCGG - Intergenic
1122872101 14:104643479-104643501 GCCCCTCCCCAGGACAGGGAAGG + Intergenic
1122882716 14:104697224-104697246 GGCCTTCCACAGCACAGTGTGGG - Intronic
1127903056 15:63355245-63355267 GCCCTGCCCCAGCGAGGGGAGGG - Intronic
1128150670 15:65361793-65361815 CCCCTACCCCAGCACGGCGGTGG - Intronic
1129456139 15:75677040-75677062 GGCCTTTGCCATCACGGTGAGGG - Exonic
1129784900 15:78303763-78303785 TCCCTGCCGCAGCCCGGTGATGG - Intergenic
1130145331 15:81269617-81269639 GCCCTTCATCAGCACGATGTTGG - Exonic
1131763110 15:95645820-95645842 TCCCTTTACCAGCACCGTGAGGG + Intergenic
1134247888 16:12553508-12553530 TCCCTCCTCCAGCACTGTGATGG - Intronic
1136588301 16:31201998-31202020 TCCCTTCCCCCGCAGGGTGTGGG + Intronic
1136627519 16:31471417-31471439 GCCCTTCCTCAGCACTGAGGTGG - Intergenic
1139795583 16:69480844-69480866 GACATTCCCCAGCACGTTGCTGG + Intergenic
1141931596 16:87208253-87208275 GCCCTTCCACATCAGGGTGGAGG - Intronic
1142147782 16:88499751-88499773 GCCCCTCCCCAGCATGGGGGTGG - Intronic
1142358916 16:89617070-89617092 GCCCCACCCGAGCAAGGTGAGGG + Intronic
1142606424 17:1083919-1083941 AGCTTTCCTCAGCACGGTGAAGG + Intronic
1145738026 17:27247292-27247314 GCACTTCCCCAGGGCAGTGATGG - Intergenic
1147663387 17:42129594-42129616 GCCCTCCCCCAGCTCACTGAGGG + Intronic
1148395223 17:47302865-47302887 GCCCTGCCCCAGGAGGGAGAGGG + Intronic
1150130185 17:62664934-62664956 GCTCTGCCCTACCACGGTGAGGG + Exonic
1150430295 17:65110097-65110119 TCTCTTCCCCTGCACAGTGATGG + Intergenic
1150660568 17:67072617-67072639 GCTCTTCCGCAGTAGGGTGAAGG - Exonic
1151384816 17:73748587-73748609 GTCCTTCAGCAGCCCGGTGAGGG + Intergenic
1151702768 17:75752256-75752278 GCCCTACCGCTACACGGTGAAGG + Exonic
1151955825 17:77379700-77379722 CCCCATCCCCGGCACGATGATGG - Intronic
1152325181 17:79631873-79631895 GCCCTTGCACAGCACCCTGACGG + Intergenic
1152460174 17:80438375-80438397 GCCCTTCCCCTGCAGGGTGGGGG + Intergenic
1152555186 17:81049548-81049570 CCCCTGCCCCAGCACTGTCAGGG + Intronic
1152839291 17:82556549-82556571 CCCCAGCCCCAGCAAGGTGAGGG - Intronic
1153805248 18:8705145-8705167 GCCCCTCCCCTGCACGGCGCCGG + Intergenic
1154367811 18:13726999-13727021 GCCCCTCCCCAGCACGGCCCTGG - Intronic
1154939905 18:21101609-21101631 CCCCTTCCCCTGCATGTTGAAGG - Intronic
1158940141 18:62400123-62400145 ACCCTTCCCCAGCACAGAAAAGG + Intergenic
1159094770 18:63890354-63890376 GCCCCTCCCCAGTTCGGGGAAGG + Intronic
1160055566 18:75476593-75476615 GCCTGTCCCCAGCAGGATGAAGG - Intergenic
1160086029 18:75778271-75778293 CCCCTCCCCCAGCACAGGGAGGG - Intergenic
1161532834 19:4800511-4800533 GACCCTCCCCAGCACTTTGAGGG + Exonic
1161700378 19:5791203-5791225 GCACTTCCCCAGCACAATCAGGG - Exonic
1161708359 19:5832967-5832989 GCCCTTCCCCAGCAGAGTCATGG - Intronic
1162124181 19:8490442-8490464 GCACTCCCCCACCACGGTCAGGG + Intronic
1162823507 19:13237241-13237263 GCCAGTACCCAGCAGGGTGAAGG + Intronic
1163110763 19:15159962-15159984 GCCCTTCCCCAGCAAGGCTATGG + Exonic
1163698889 19:18777422-18777444 GCGCCTCCCCAGCCCGGGGACGG + Exonic
1164846855 19:31439721-31439743 GCCCTTCCCCAGCTAGGGGCTGG - Intergenic
1167821653 19:51933702-51933724 CCCCCTCCCCAGCTCAGTGATGG - Intronic
925981880 2:9183946-9183968 GCCCCTCCCCCGCACAGAGAAGG + Intergenic
926162606 2:10499411-10499433 GCCCTCCCCCCGCACAGTGCAGG - Intergenic
927177745 2:20422280-20422302 GCACTTCCCCAGCTCTCTGATGG + Intergenic
927661480 2:24997048-24997070 GCACTTCCCCAACAGGGGGACGG + Intergenic
928461465 2:31477133-31477155 CCCCTTCCTCATCACTGTGATGG - Intergenic
932308224 2:70719009-70719031 GCTCTTCCCCAGCACAGAAATGG + Intronic
933474066 2:82766450-82766472 GGCCTGCCCCAGCACTGTGTTGG + Intergenic
934039447 2:88115831-88115853 GCCATTCCCCAGAAAGGTGCTGG - Intergenic
935174572 2:100638508-100638530 GCTCTTCCCCAGCACTGTCAAGG + Intergenic
936095832 2:109529453-109529475 GCCCAGCCCCTGCACGGGGAAGG + Intergenic
938064189 2:128272217-128272239 TCCCCTCCCCAGCACCGTCACGG + Intronic
940732958 2:157415694-157415716 CCTCTTCCACAGCACGATGAAGG + Exonic
940739308 2:157488993-157489015 GCCCTCCCCCAGCTCTGTGCAGG - Intergenic
941718258 2:168786548-168786570 GCCCTTCCCAAGCACTGGTAGGG + Intronic
942851626 2:180494535-180494557 TCCCTTCCCCAGCTGGGTGGTGG + Intergenic
944478690 2:200132690-200132712 GCACTCCCACAGCAGGGTGAGGG - Intergenic
946305569 2:218855240-218855262 TCTTTTCCCCAGCACGGTCAAGG + Intergenic
946359011 2:219207710-219207732 GCTCTCCCACAGCACGGTCAGGG - Exonic
947714622 2:232333379-232333401 ACCCTTCCCCAGCATGGGGCCGG - Intronic
1169914796 20:10674107-10674129 CCCCCTCCCCAGCAACGTGAAGG - Exonic
1172508216 20:35479854-35479876 GTCCTTCTCCAGCAGGGTGCAGG + Intronic
1172764408 20:37343660-37343682 GCCCATGCCCAGCACGGAGCAGG - Intergenic
1175863705 20:62163539-62163561 GCCCTGCCCCATCATGGCGATGG - Exonic
1176268963 20:64225558-64225580 GCCTGTCCACAGCACGGGGATGG + Intronic
1180160087 21:45995251-45995273 GCACTTCCCCAGGAAGGTGTCGG - Intronic
1180211118 21:46295909-46295931 GCCCCTCCCCAGCACAGTGCTGG + Intronic
1183315251 22:37133509-37133531 GACTTTCCCCAGCACTGGGAAGG - Intronic
1183390265 22:37541722-37541744 ACCCTTGCACAGCACAGTGAGGG - Intergenic
1184537825 22:45099625-45099647 GGCCTCCCCCAGCACAGAGAAGG - Intergenic
1185190507 22:49433260-49433282 GACCTTCCCCAGCAGGGAGAGGG - Intronic
1185190523 22:49433341-49433363 GACCTTCCCCAGCAGGGAGAGGG - Intronic
1185190554 22:49433463-49433485 GACCTTCCCCAGCAGGGAGAGGG - Intronic
1185190587 22:49433586-49433608 GACCTTCCCCAGCAGGGAGAGGG - Intronic
954901645 3:54025288-54025310 CCCCTTCCTCAGCACCTTGAGGG - Intergenic
960573875 3:119210621-119210643 GCCCTTCCCAACCATGATGAGGG + Intergenic
961440737 3:126951699-126951721 GCCCATCCCCAGCTGGATGAGGG - Intronic
961521929 3:127472078-127472100 GCCCCTCCCCAGGTCAGTGAGGG + Intergenic
966819586 3:183914378-183914400 TCCCCTCTACAGCACGGTGAAGG + Intergenic
968513361 4:1004864-1004886 CCCGTACCCCAGCACGGTGGAGG + Intergenic
998153692 5:139771982-139772004 ACCCTTCCCCAGCCAGGTGAGGG + Intergenic
999498054 5:152119521-152119543 TCCCTTACCCAGCACCTTGATGG - Intergenic
1000037729 5:157461461-157461483 GCCCTTCCCCTGCTCCCTGAAGG - Intronic
1001934367 5:175694079-175694101 GTCCTTCCCCAGCCCTGGGAGGG - Intergenic
1002475280 5:179461720-179461742 GCACCTCCCCAGGGCGGTGATGG + Intergenic
1011002513 6:82606890-82606912 GCCCTGCTGCAGCACTGTGATGG + Intergenic
1012213250 6:96550641-96550663 CTCCTTCCCCAGCAAGGTGCTGG + Intronic
1019607865 7:1919044-1919066 GCCCCTCCCCAGCAAGGACAGGG + Intronic
1021310553 7:19090641-19090663 GCTCTTCCCCAGCAATGAGAAGG - Intronic
1024229066 7:47350233-47350255 CCCCTTCCTCAGCAGGATGAGGG - Intronic
1027255528 7:76428432-76428454 GCCCTACCCCAGTAGAGTGAAGG - Intronic
1034559019 7:151867886-151867908 TCCCCTCCCCAGCACAGTGGAGG + Intronic
1039602264 8:38850133-38850155 GCCCTTCCCTAGCACACTGGTGG + Exonic
1041622715 8:59990752-59990774 GGCCTTCCCCAGCACCAGGAAGG - Intergenic
1049812569 8:144582072-144582094 ACCCCTCACCAGCCCGGTGATGG - Intronic
1052992111 9:34524525-34524547 CCCATTACCCAGCAGGGTGAGGG + Intergenic
1056470960 9:86904126-86904148 GTGCTTCTCCAGCAGGGTGAAGG + Intergenic
1060053230 9:120391752-120391774 GCTCTTCCCCATCACCATGAGGG + Intronic
1060166624 9:121422638-121422660 TCCCCTCCCCAGCACAGGGAAGG + Intergenic
1060183862 9:121552103-121552125 GCCCCTCCCCAGCACCCAGAGGG + Intergenic
1061837139 9:133336808-133336830 TCCCTCCCCCACCCCGGTGACGG + Intergenic
1185626518 X:1486646-1486668 GCTGTTGCCCAGCACTGTGAAGG + Intronic
1198601240 X:138286238-138286260 GCCTCTCCCCAGCTCTGTGAGGG - Intergenic
1199659067 X:150029136-150029158 GCCCTTCCCCAGCTCAGATAAGG + Intergenic
1200117326 X:153775088-153775110 GCTCTTCCTCCTCACGGTGAGGG + Exonic
1200175122 X:154108775-154108797 GACCTGCCCCTGCAGGGTGAGGG + Intergenic
1200180082 X:154144716-154144738 GCTCTTCCCCAGGAAGCTGAGGG - Intronic
1200185910 X:154183110-154183132 GCTCTTCCCCAGGAAGCTGAGGG - Intergenic
1200191562 X:154220248-154220270 GCTCTTCCCCAGGAAGCTGAGGG - Intronic
1200197317 X:154258052-154258074 GCTCTTCCCCAGGAAGCTGAGGG - Intronic