ID: 1076758405

View in Genome Browser
Species Human (GRCh38)
Location 10:132587382-132587404
Sequence GAGCACACCATGGGCTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 163}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076758405_1076758412 -8 Left 1076758405 10:132587382-132587404 CCAGCACAGCCCATGGTGTGCTC 0: 1
1: 0
2: 1
3: 12
4: 163
Right 1076758412 10:132587397-132587419 GTGTGCTCTGTGGGGCTGGCAGG No data
1076758405_1076758415 5 Left 1076758405 10:132587382-132587404 CCAGCACAGCCCATGGTGTGCTC 0: 1
1: 0
2: 1
3: 12
4: 163
Right 1076758415 10:132587410-132587432 GGCTGGCAGGGATCCTGGCATGG No data
1076758405_1076758414 0 Left 1076758405 10:132587382-132587404 CCAGCACAGCCCATGGTGTGCTC 0: 1
1: 0
2: 1
3: 12
4: 163
Right 1076758414 10:132587405-132587427 TGTGGGGCTGGCAGGGATCCTGG No data
1076758405_1076758417 21 Left 1076758405 10:132587382-132587404 CCAGCACAGCCCATGGTGTGCTC 0: 1
1: 0
2: 1
3: 12
4: 163
Right 1076758417 10:132587426-132587448 GGCATGGCCTGTGTGATTCGAGG No data
1076758405_1076758413 -7 Left 1076758405 10:132587382-132587404 CCAGCACAGCCCATGGTGTGCTC 0: 1
1: 0
2: 1
3: 12
4: 163
Right 1076758413 10:132587398-132587420 TGTGCTCTGTGGGGCTGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076758405 Original CRISPR GAGCACACCATGGGCTGTGC TGG (reversed) Intronic
900360247 1:2284796-2284818 GGGCCCACCTTGGCCTGTGCTGG + Intronic
901322871 1:8350072-8350094 GAGCTCATCAGGGGCTGAGCAGG + Intergenic
902374672 1:16024760-16024782 CAGCACACCAGTGGCTGTACAGG + Exonic
903323699 1:22557157-22557179 GAGGTGACAATGGGCTGTGCAGG + Intergenic
905416711 1:37808737-37808759 GTGCCCACCCTGGGCTGGGCTGG + Intronic
908615117 1:65911751-65911773 GAGAACCCCATGGGCTTTTCAGG - Intronic
913975317 1:143450774-143450796 GCGCTCACCATGAGCTGCGCCGG + Intergenic
914069709 1:144276390-144276412 GCGCTCACCATGAGCTGCGCCGG + Intergenic
914109446 1:144689964-144689986 GCGCTCACCATGAGCTGCGCCGG - Intergenic
918038210 1:180895901-180895923 GAGCACACCTGTGGCTGTACGGG + Intergenic
919920249 1:202163037-202163059 AAGCACACCATGGGCTGACAAGG - Intergenic
920128754 1:203714367-203714389 AAGCACCCCATGGGCTATGCAGG - Intronic
920268205 1:204742864-204742886 GAACACACCATGAGCCGTGGGGG + Intergenic
921153256 1:212418328-212418350 TAGCACATGATGGTCTGTGCGGG + Intergenic
1062836162 10:637207-637229 CAACACACCATAGGCTGGGCGGG + Intronic
1062836175 10:637286-637308 CAACACACCATAGGCTGGGCGGG + Intronic
1062836187 10:637365-637387 CAACACACCATAGGCTGGGCGGG + Intronic
1069661625 10:70127086-70127108 GTGCACACCAGGAGCTGCGCAGG + Intronic
1069886709 10:71628250-71628272 GAGCCCAGCATGGGCTGGGAAGG - Intronic
1073095846 10:100979260-100979282 GAGCACACAGTGGTCAGTGCAGG + Exonic
1074056455 10:109926596-109926618 GTTCACTCCATGGGCTGTGAGGG - Intergenic
1076426702 10:130372194-130372216 GAGCACTGCATGGGCAGGGCTGG + Intergenic
1076525251 10:131108662-131108684 GATCACTCCCTGGGCTGTGTGGG + Intronic
1076551289 10:131279595-131279617 GAGAAGACCATGGGCCATGCTGG + Intronic
1076758405 10:132587382-132587404 GAGCACACCATGGGCTGTGCTGG - Intronic
1076854250 10:133108149-133108171 GAGCACACCTGGGAGTGTGCAGG + Intronic
1077155584 11:1089481-1089503 GAGAACACCCTGGTCTGTCCTGG - Intergenic
1077330821 11:1983128-1983150 GCCCCCACCAGGGGCTGTGCAGG + Intronic
1077551209 11:3201105-3201127 GAGGAGGCCAGGGGCTGTGCGGG - Intergenic
1080432081 11:32208684-32208706 GAGGACATCATGGGCTGTGCCGG + Intergenic
1081761209 11:45577467-45577489 GAGCAGCCCATGGGCAATGCTGG - Intergenic
1081964568 11:47161679-47161701 GGGCACACCAAGGGCTGGGTGGG - Exonic
1084320055 11:68368284-68368306 GAACACAGCAGGGGCTGAGCCGG + Intronic
1085516461 11:77114766-77114788 TAGCAGACCCTGTGCTGTGCTGG + Intronic
1085923599 11:80988662-80988684 GAGCAGCCCATGGCCTGTCCAGG + Intergenic
1086478548 11:87207813-87207835 GAGCACACCATGGGGATGGCAGG - Intronic
1087471480 11:98581103-98581125 GAGAGTACCATGGGCTGAGCAGG + Intergenic
1088246607 11:107824497-107824519 GTTCACACCATGTGCTGTTCTGG + Intronic
1088691605 11:112333206-112333228 GACCATAGCAAGGGCTGTGCTGG - Intergenic
1089015907 11:115165075-115165097 GTGGACACCCTGGGCTGTGGAGG - Intergenic
1202813801 11_KI270721v1_random:38307-38329 GCCCCCACCAGGGGCTGTGCAGG + Intergenic
1094045125 12:26158871-26158893 GACCACACAATGGGCTCTACTGG - Intronic
1095398401 12:41787386-41787408 CAGCATACCATGGCTTGTGCTGG - Intergenic
1096405320 12:51339888-51339910 AAGAACACCATGGTGTGTGCTGG - Exonic
1107682694 13:42867628-42867650 GAGCACCCCATAAGCTGTCCTGG - Intergenic
1113595445 13:111528573-111528595 CAGTACATCATGGGCTGTCCAGG - Intergenic
1120696778 14:87653778-87653800 GAGCAGACCCTGAGCTGTTCTGG + Intergenic
1122788463 14:104174574-104174596 GAGCACCCCAGGGCCTGTGCGGG - Intronic
1122909567 14:104820777-104820799 GAGCACCCCGTGGGCGCTGCGGG + Intergenic
1126152439 15:45535714-45535736 GAGGACAGCATGGGCTGAGGGGG - Intergenic
1129741850 15:77993097-77993119 GTGCCCACCATGGGCTGTGGCGG + Intronic
1129843858 15:78759362-78759384 GTGCCCACCACGGGCTGTGGCGG - Exonic
1129903806 15:79172169-79172191 GAGGCCACCAGGGGCTGTGGAGG + Intergenic
1130257951 15:82334438-82334460 GTGCCCACCACGGGCTGTGGCGG + Intergenic
1130327783 15:82895635-82895657 GAGCACTAAATGGGCTGGGCTGG + Intronic
1130596983 15:85255525-85255547 GTGCCCACCACGGGCTGTGGCGG - Intergenic
1130970384 15:88727578-88727600 GGGCAGACCAAGGGCTGGGCTGG + Intergenic
1131992839 15:98107383-98107405 GAGGACACCATGGGCTTTTTGGG + Intergenic
1132098091 15:99003087-99003109 GAGGACACCATGGGCTTTTTGGG - Intronic
1132674604 16:1116524-1116546 GAGCACTCCCTGGGCTCAGCAGG + Intergenic
1132990011 16:2787506-2787528 GAGCAAGCCAGGGGCTGTGGGGG - Intronic
1137060608 16:35789242-35789264 GAGCACAAGAGGGCCTGTGCTGG + Intergenic
1139964492 16:70737945-70737967 GAGCCCACAACGGGCTGTCCGGG - Intronic
1141587871 16:85047196-85047218 TAGCACTCCATGGCCTGTGTGGG + Intronic
1142160759 16:88556186-88556208 GTGCTCACCATGGGCTGGGCGGG - Intergenic
1146338233 17:31993912-31993934 GAGTACACCAAGGGCAATGCAGG - Exonic
1146624564 17:34425360-34425382 GAGCCCACCCTCGGCTGAGCTGG - Intergenic
1147628196 17:41913569-41913591 AAGCATGCCATGGGCTGAGCAGG - Intronic
1152429139 17:80237783-80237805 CAGCACACCATGGGGTGGGAGGG - Intronic
1157335249 18:46733067-46733089 GTGGACCCCCTGGGCTGTGCTGG - Intronic
1160117770 18:76098030-76098052 GAGCAGACCACGGGCTCTTCAGG + Intergenic
1160375929 18:78411688-78411710 GGGCACACCAAGAGCTGTCCAGG - Intergenic
1160695166 19:480373-480395 GAGCAAAACGTGGGCGGTGCCGG + Intergenic
1160820992 19:1057965-1057987 GAGCACCACATAGGCTGTGCTGG - Exonic
1161331798 19:3692092-3692114 GCGCCCACCATGGGCAGGGCCGG + Intronic
1162763124 19:12900321-12900343 GAGTGCACCAAGGGCTTTGCAGG + Intronic
1163294453 19:16403324-16403346 GAACACACCAGTGGCTGTGGAGG + Intronic
1164524589 19:29003991-29004013 GTGCACAGCATGGCCTGAGCTGG - Intergenic
1165496053 19:36152368-36152390 GAGGCCCCCATGGGCTGGGCCGG - Intronic
1166054135 19:40278656-40278678 GAGCACAGAAGGGGCTCTGCAGG - Intronic
1167610958 19:50507538-50507560 CAGCACAGCATGTGCTGGGCCGG - Intronic
926058881 2:9792903-9792925 GAGCACAGCTGCGGCTGTGCTGG - Intergenic
927192770 2:20528079-20528101 AGGGACACCATGGGCTGTGCAGG + Intergenic
928366298 2:30705935-30705957 GAGCCCACTGTGGGCTTTGCAGG - Intergenic
929593534 2:43161929-43161951 GATCACACCAAGGACTCTGCAGG - Intergenic
934180017 2:89611747-89611769 GCGCTCACCATGAGCTGCGCCGG + Intergenic
934290312 2:91686008-91686030 GCGCTCACCATGAGCTGCGCCGG + Intergenic
934570951 2:95373018-95373040 GGGCACAGGATGAGCTGTGCAGG + Intronic
935563077 2:104578364-104578386 GGGCACACCATGGGCCCTACAGG + Intergenic
936071765 2:109375854-109375876 GAGCAGCCCATGGGCAGTTCAGG + Intronic
937982161 2:127622161-127622183 AGGCACCCCATGAGCTGTGCTGG - Intronic
938462578 2:131507472-131507494 GTGTAGACCGTGGGCTGTGCTGG + Intergenic
941546811 2:166861313-166861335 GAGTAAACCATGGCCTGTTCGGG + Intergenic
941928033 2:170915454-170915476 GAGGCCACCATGGGCAGTGGGGG + Intergenic
942252291 2:174057565-174057587 GAGCACACCATGGGGTGAGGTGG + Intergenic
1170678344 20:18502855-18502877 GAACACAGCCTGGGCTGTTCTGG - Intergenic
1170910811 20:20566048-20566070 GAGCAGACAGTGGGCTCTGCTGG - Intronic
1171904901 20:30892888-30892910 GAGCACACCCTGTCCTGAGCCGG + Intergenic
1173396685 20:42686781-42686803 GAGTGCACTATGGGCTGAGCAGG - Intronic
1174068536 20:47883399-47883421 GCCCTCACCATGGGCTGTGGAGG + Intergenic
1175077207 20:56385863-56385885 GAGGTCACCATGGGCATTGCTGG - Intronic
1175411329 20:58771575-58771597 CTGCACATCAGGGGCTGTGCTGG - Intergenic
1175760012 20:61556028-61556050 GAGCCCACCATGGGGTGCACCGG - Intronic
1175958974 20:62625567-62625589 GACCACACCCTGGGCAGGGCCGG - Intergenic
1177708979 21:24746207-24746229 AAGTAAACCATGGGCTGGGCTGG - Intergenic
1178453650 21:32727764-32727786 GAGCAGACCACTGGTTGTGCGGG - Intronic
1179491519 21:41744409-41744431 GAGCATCCCAAGTGCTGTGCGGG - Intronic
1180075260 21:45458686-45458708 GAGGACAAGGTGGGCTGTGCTGG - Intronic
1181061638 22:20284682-20284704 GAGCAGACCATGGGCTAGCCAGG - Intergenic
1181546125 22:23603597-23603619 GAGGAGACCAAGGGCTGTGGCGG - Intergenic
1184227273 22:43136281-43136303 TAGCACAGGATGGGCTGTGAGGG + Intronic
1184976039 22:48063005-48063027 TAGCTCACAATGGCCTGTGCAGG + Intergenic
1185058813 22:48594932-48594954 CAGCACACCTTCGGCTGAGCAGG + Intronic
950972842 3:17206198-17206220 CAGACCACCATGGGCTGTGTTGG - Intronic
954260172 3:49433039-49433061 GAGAGCCCCATAGGCTGTGCAGG - Intergenic
954624577 3:52015597-52015619 CAGCATGCCCTGGGCTGTGCCGG + Intergenic
954999989 3:54918735-54918757 GACCACACCGTGGGCAGAGCCGG + Exonic
956278969 3:67536139-67536161 GTGCACACCAAGAGCTGTTCTGG - Intronic
956696523 3:71923376-71923398 CAGCAGAACACGGGCTGTGCAGG + Intergenic
962845447 3:139270153-139270175 GTGGACACCATGGGAAGTGCTGG + Intronic
963085203 3:141429781-141429803 GAGCCAGCCATGGGCAGTGCCGG + Intronic
968639213 4:1702876-1702898 GAGCACTCCATCTACTGTGCTGG + Intronic
968660830 4:1798106-1798128 GGACACACCATGGGCAGGGCTGG - Intronic
969633709 4:8353155-8353177 GGCCACACCCTGGGCTGTTCGGG + Intergenic
969721283 4:8894175-8894197 GAGGACAGCACGGGCTGGGCCGG - Intergenic
969829262 4:9781883-9781905 GCGCTCACCATGAGCTGCGCCGG - Exonic
976142400 4:82006001-82006023 GAGGAGAAGATGGGCTGTGCTGG + Intronic
982463144 4:155696083-155696105 GAACATACCATGGGATTTGCAGG - Intronic
983518342 4:168679603-168679625 GTGCACACCATTAGATGTGCAGG + Intronic
984705882 4:182846769-182846791 GAGCAGGCCATGGGGTGTGCTGG - Intergenic
985621339 5:957738-957760 GAGCGCAACCTGGGCTGGGCTGG - Intergenic
988162162 5:27532452-27532474 GAACACAGCTTGGGCTGTTCTGG + Intergenic
992427984 5:76677995-76678017 GAGAACACCATAGCCTGTCCTGG - Intronic
997712530 5:136017849-136017871 AAGCACACCATTGTCTGTGAAGG - Intergenic
998299225 5:141002081-141002103 GAGCAGTCCAGGGGCTGGGCCGG + Intronic
999495436 5:152091923-152091945 GAGCCCATCATTGGCAGTGCAGG - Intergenic
1000112055 5:158117658-158117680 GAGCACATCAGGGGATTTGCTGG - Intergenic
1001022901 5:168198728-168198750 GAGGAGACCATGGGCTTTGGAGG - Intronic
1007270322 6:40631125-40631147 GAGAAGACCATGTGCTGAGCTGG - Intergenic
1011733066 6:90285743-90285765 GAGCTCTCCAAGGGCGGTGCTGG + Intronic
1012413220 6:98983876-98983898 GAGCAGACCATGTGCAGAGCAGG - Intergenic
1014676216 6:124369714-124369736 AAGCACACCAGGGGCTGGGGTGG - Intronic
1017695389 6:157009877-157009899 GGTCAAACCATGGGCTGTGTAGG - Intronic
1019038537 6:169083362-169083384 GAGCTCACCGTGGGCTGTGTGGG - Intergenic
1019065099 6:169289767-169289789 GAGCACACCCTGGACTGAGATGG + Intergenic
1019180719 6:170186098-170186120 GAGCCCAGCCTGGCCTGTGCCGG - Intergenic
1023027320 7:36062490-36062512 AACAACACCAAGGGCTGTGCAGG + Intergenic
1023430736 7:40088263-40088285 CAGCACACCCTGGGGTGTGTTGG - Exonic
1023735807 7:43235091-43235113 GAGCACACCTGGGGCTGGCCAGG + Intronic
1025006296 7:55357937-55357959 GAGCACACACTGGGCTGTGTAGG + Intergenic
1027216848 7:76189268-76189290 GAGCATATCATGGGGTGTGAGGG + Intergenic
1028733128 7:94176192-94176214 CACCACACCATGGGCTGAGATGG - Intergenic
1031550041 7:123098701-123098723 GTGCACAACATGGGCAGTGATGG + Intergenic
1032514252 7:132495144-132495166 ACTCACACCAGGGGCTGTGCAGG - Intronic
1032548460 7:132762676-132762698 GAGCACCCCTTGGGCAGTCCTGG + Intergenic
1035319961 7:158022415-158022437 GAACACATCATGGGCTGCGCTGG - Intronic
1036784601 8:11677542-11677564 GAGGACACCAAGGGCTGCGGGGG - Intronic
1037834581 8:22208566-22208588 GGGCACACTCTGGGCTGGGCTGG - Intronic
1041222136 8:55662609-55662631 GATAACAACATGAGCTGTGCTGG + Intergenic
1041661152 8:60402815-60402837 GAGCTCCCCATGAGCTGAGCTGG + Intergenic
1046743129 8:117849176-117849198 GAGCACAGGTTGGTCTGTGCTGG - Intronic
1049160829 8:141096472-141096494 GAACACCCCGTGGGATGTGCTGG + Intergenic
1049553728 8:143272192-143272214 GAGGACCCCATGGGCAGGGCAGG + Intronic
1051142616 9:13993989-13994011 CAGGAGGCCATGGGCTGTGCAGG + Intergenic
1051610842 9:18960090-18960112 GAGCACCTCATGGGCTCTTCCGG + Intronic
1052158448 9:25225294-25225316 TGGCACACAATTGGCTGTGCTGG + Intergenic
1056318117 9:85410735-85410757 GTGAACACCACTGGCTGTGCTGG + Intergenic
1056842303 9:90008297-90008319 AATCACACCATGGGCTTTCCTGG - Intergenic
1056887042 9:90453171-90453193 GAGCACACCTGGGGCAGTCCGGG - Intergenic
1057418063 9:94883143-94883165 GCGCACACAATTGGCTCTGCAGG + Intronic
1058416693 9:104796125-104796147 GAGCACCACATAGGCTGTGCTGG + Exonic
1061439365 9:130589747-130589769 CACCACACCATAGCCTGTGCAGG - Intronic
1062085558 9:134646256-134646278 GGGCCCTCCATGGGATGTGCTGG + Intronic
1062450572 9:136614118-136614140 GTGCACCTCCTGGGCTGTGCTGG + Intergenic
1200018831 X:153185052-153185074 GGGAACAACATGGGCTCTGCAGG - Intergenic
1200625033 Y:5501148-5501170 GGGCAGGCCATGGGATGTGCTGG - Intronic
1201073451 Y:10170080-10170102 GAGCACACCCTGTCCTGAGCCGG + Intergenic