ID: 1076758409

View in Genome Browser
Species Human (GRCh38)
Location 10:132587391-132587413
Sequence AGCCCCACAGAGCACACCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 149}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076758409_1076758417 12 Left 1076758409 10:132587391-132587413 CCCATGGTGTGCTCTGTGGGGCT 0: 1
1: 0
2: 2
3: 10
4: 149
Right 1076758417 10:132587426-132587448 GGCATGGCCTGTGTGATTCGAGG No data
1076758409_1076758415 -4 Left 1076758409 10:132587391-132587413 CCCATGGTGTGCTCTGTGGGGCT 0: 1
1: 0
2: 2
3: 10
4: 149
Right 1076758415 10:132587410-132587432 GGCTGGCAGGGATCCTGGCATGG No data
1076758409_1076758421 30 Left 1076758409 10:132587391-132587413 CCCATGGTGTGCTCTGTGGGGCT 0: 1
1: 0
2: 2
3: 10
4: 149
Right 1076758421 10:132587444-132587466 CGAGGTCAGAAATCATGACGGGG No data
1076758409_1076758420 29 Left 1076758409 10:132587391-132587413 CCCATGGTGTGCTCTGTGGGGCT 0: 1
1: 0
2: 2
3: 10
4: 149
Right 1076758420 10:132587443-132587465 TCGAGGTCAGAAATCATGACGGG No data
1076758409_1076758414 -9 Left 1076758409 10:132587391-132587413 CCCATGGTGTGCTCTGTGGGGCT 0: 1
1: 0
2: 2
3: 10
4: 149
Right 1076758414 10:132587405-132587427 TGTGGGGCTGGCAGGGATCCTGG No data
1076758409_1076758419 28 Left 1076758409 10:132587391-132587413 CCCATGGTGTGCTCTGTGGGGCT 0: 1
1: 0
2: 2
3: 10
4: 149
Right 1076758419 10:132587442-132587464 TTCGAGGTCAGAAATCATGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076758409 Original CRISPR AGCCCCACAGAGCACACCAT GGG (reversed) Intronic
901316951 1:8316007-8316029 AGGGCCCCAGAGGACACCATGGG - Intergenic
901379308 1:8862452-8862474 AGCCCCACAGCGCTCACAAGTGG + Intronic
902927805 1:19708562-19708584 GGCCCCACAGAGAACACTTTCGG + Intronic
904272928 1:29362259-29362281 AGCCCCACTGTGCACCCCACAGG - Intergenic
905245895 1:36613102-36613124 AGACCCACGGAGGACACCACTGG + Intergenic
907902478 1:58753576-58753598 AGCCACACATAGCACACAGTAGG - Intergenic
907957449 1:59243546-59243568 AGCCTTGCAGAGCACACCTTTGG - Intergenic
910515825 1:88058960-88058982 AGCCCCACAGAGCCAAATATAGG - Intergenic
915362309 1:155293510-155293532 AGCCCCATCCAGCACAGCATTGG + Exonic
915607063 1:156959093-156959115 AGCTTCACAGAGAACACCACGGG + Exonic
916141935 1:161707308-161707330 GGCCACCCAGAGCACACCAAGGG - Exonic
920651487 1:207840554-207840576 GGCCCCACAGAGGCCACCAGGGG + Intergenic
922569086 1:226622644-226622666 AGCCACACAGAGGACATCAGTGG + Intergenic
922712704 1:227845386-227845408 TGCCCCACAGTGGACACCAAGGG - Intronic
1063383333 10:5600445-5600467 AGCCCCACGGAGGACAGCGTGGG - Intergenic
1064289387 10:14019907-14019929 AGCCCCACAACGCACCCCAAAGG - Intronic
1065952309 10:30663319-30663341 ACCCCCACACACCACACCACCGG + Intergenic
1066441811 10:35446749-35446771 AGCCCCACAGATCCCACAAGGGG - Intronic
1067295085 10:44971131-44971153 AGCCCCACAGAGCCCAGCTTGGG + Intronic
1070793111 10:79201458-79201480 AGCCCCACAGGGCCCAGCAAAGG + Intronic
1071325581 10:84513482-84513504 AGACCCACAGATCACACCCAGGG + Exonic
1071859883 10:89661643-89661665 AGATACACAGAGGACACCATAGG + Intergenic
1073441679 10:103556060-103556082 TCCCCCACAGAGCACACACTTGG - Intronic
1076427499 10:130378247-130378269 GGCCTCACAGAGCACCCCCTCGG - Intergenic
1076758409 10:132587391-132587413 AGCCCCACAGAGCACACCATGGG - Intronic
1076850611 10:133090700-133090722 AGCCCCCCAGAGCACAGCAGTGG - Intronic
1077516420 11:3004553-3004575 GGGCCCCCAGTGCACACCATGGG - Intronic
1078533735 11:12156714-12156736 ATCCCCACAGAGCCCACCATGGG - Intronic
1085317719 11:75555457-75555479 GACCCCACAGAGGCCACCATGGG - Intergenic
1088795542 11:113264306-113264328 TGCCCCTCAGACCACAGCATGGG - Intronic
1090581665 11:128167012-128167034 AGCCTCCCAGAGCACACAAAGGG - Intergenic
1092731537 12:11539630-11539652 AACCCCAAATAGCACAACATGGG + Intergenic
1098243045 12:68487840-68487862 AGCCCCACTGAGGACCCGATGGG - Intergenic
1100909137 12:99338315-99338337 AGCCACACAGTACACAACATGGG - Intronic
1103732067 12:123034323-123034345 AGGCGCACAGAGCACACCATGGG - Intronic
1104915005 12:132260071-132260093 AGCCCCACAGAGGGCACCTACGG - Intronic
1105587238 13:21756545-21756567 AGCACCACAGACCTCACCATGGG - Intergenic
1107210844 13:37852467-37852489 ATCCCCAGAGAGTACACAATGGG + Intronic
1110329601 13:74256348-74256370 AGACCCACAAAGCACAACAGTGG - Intergenic
1112498853 13:99926797-99926819 AGCCCCCACGAGCTCACCATGGG + Intergenic
1114686276 14:24534733-24534755 AGCTCCACAGAGCACAGTATTGG + Intergenic
1118778250 14:68987968-68987990 AGCCAATCAGAGCACACGATTGG + Intergenic
1121629348 14:95411223-95411245 AGCCCCAGAAAGCAGACAATGGG - Intronic
1124882321 15:33654014-33654036 AGTTCCACAGAGCAAACTATGGG + Intronic
1127370118 15:58331360-58331382 AGACCCACAGAGCATAGAATGGG + Intronic
1127895146 15:63291908-63291930 AGCCACACAGAGCCCACCCCAGG + Intronic
1128087687 15:64897292-64897314 AGCCCCACACAGGATGCCATGGG + Intronic
1128883076 15:71261197-71261219 ACCCACACAGAGAGCACCATGGG + Intronic
1128901786 15:71429347-71429369 GGGCCCACAGAGCAGACAATGGG + Intronic
1132537159 16:487967-487989 AGCCCCACACAGGACAGCACAGG - Intronic
1132780455 16:1621565-1621587 AGCCCCAGACAGCACACCCCAGG - Intronic
1133885804 16:9826416-9826438 AGCTCATCTGAGCACACCATGGG + Intronic
1139842957 16:69896681-69896703 ACCCCCCCAGAGCTGACCATTGG + Intronic
1140141642 16:72264010-72264032 AGCCACACAGAGCAGAACAGGGG - Intergenic
1141260370 16:82447993-82448015 AGACACAGAGAGCACATCATAGG - Intergenic
1141633714 16:85302901-85302923 AGACCCACTGAGCACCCCGTTGG - Intergenic
1142231135 16:88900835-88900857 AGCCTCCCAGGGCCCACCATCGG + Intronic
1144308919 17:13994526-13994548 AGCCACACAGAGCCCATCCTAGG + Intergenic
1146632723 17:34482632-34482654 ACCTGCACAGAGCATACCATCGG - Intergenic
1146945520 17:36870591-36870613 AGCCCCTCAGAGCACAACCCAGG - Intergenic
1148768304 17:50052304-50052326 AGAGCCCCAGAGCACACCAATGG - Intergenic
1148779436 17:50113126-50113148 AGCTCCACAGAGTACACCTGGGG - Intronic
1149543616 17:57487176-57487198 GGCCCCACAGAGCACAGTACTGG - Intronic
1151239920 17:72749718-72749740 AGCCCCACACTGCACACCGAAGG + Intronic
1151946655 17:77323418-77323440 AGCCCAACAGAGCTCCCCAGTGG - Intronic
1152643081 17:81457265-81457287 AGCCCCACAGAGCGGCCCAGAGG + Intronic
1153469235 18:5425140-5425162 TTCCCCAAAGAGCACACAATGGG + Intronic
1157488277 18:48104980-48105002 ACTCCCACAGTGCTCACCATTGG + Intronic
1161389950 19:4015675-4015697 AGCACCACAGAGTGCACCCTGGG - Intronic
1161955286 19:7490722-7490744 AGGCCCAGAGAGCACACAAGTGG - Intronic
1163849950 19:19657133-19657155 AGCCCCACACAGAACACCTGTGG + Exonic
1165022893 19:32938155-32938177 AGCCTCAGAGAGCCCACCAGAGG - Intronic
1165781181 19:38435016-38435038 AGCCCCTCAGCAGACACCATGGG + Intronic
1166794096 19:45415808-45415830 AGGCCCAGAGAGCAAACCACTGG - Intronic
925170126 2:1745011-1745033 AGCCCCAAAGCGCACAGCAAGGG + Intergenic
927239878 2:20912096-20912118 AGCCCCATAGACCACACTTTAGG + Intergenic
928884006 2:36127912-36127934 AGCCACACAGAGCACAATACAGG + Intergenic
928982105 2:37146660-37146682 AGCCACACCTAGGACACCATGGG - Intronic
929275189 2:40017480-40017502 AGTCCCAGAGAGTACACCTTTGG - Intergenic
932599122 2:73112153-73112175 AGCCCCACACAGCGCACGTTTGG + Intronic
932838607 2:75060760-75060782 AGGCCCGCAGAGCACCCCAAAGG - Intronic
934551666 2:95266779-95266801 GGTCCCCCAGAGCACCCCATAGG + Intergenic
936500105 2:113059985-113060007 AGTCCCATAGAACACATCATGGG - Intronic
938130823 2:128714529-128714551 AGCCCCACAGACCACACAGGAGG - Intergenic
938248659 2:129797463-129797485 AGCTTCCCAGAGCACACCCTTGG + Intergenic
948509547 2:238454553-238454575 AGTGCCAGAGAGCACACCCTGGG + Intergenic
1169910029 20:10640417-10640439 AGCCTCACAGAGCTCAGCAGTGG + Intronic
1170392664 20:15892129-15892151 AGCCTCCCAGAGCACAGCAGGGG + Intronic
1170627232 20:18039045-18039067 AGACCCAAAGAGCACACTATGGG + Intronic
1174271675 20:49373888-49373910 AGCAGCACAGAGCAAACCAAAGG - Exonic
1175363736 20:58435878-58435900 AGCCAAACAGAACACACCCTTGG - Intronic
1175820569 20:61906820-61906842 GGCCCCACAGCACACACCACTGG - Intronic
1178389327 21:32185430-32185452 AGCACCACAGACCTCCCCATGGG - Intergenic
1179967614 21:44816607-44816629 AGGCCGACAGTGCACACCAAGGG + Intronic
1180039965 21:45270854-45270876 AGCGCCACAGAGCACCCCGTGGG + Intronic
1180077958 21:45472718-45472740 AGCCTCACAGAGCGCACCAGCGG - Intronic
1180905902 22:19411372-19411394 AGCCCCAAAGAGCCCAGTATGGG + Intronic
1183298074 22:37043790-37043812 AGCAGCACAGAGCACTCCTTGGG + Intergenic
1184527955 22:45036605-45036627 AGCCATGCAGAGCACACCCTGGG - Intergenic
1185075556 22:48680242-48680264 AGCCCCACAGAGCCCCAAATTGG - Intronic
952854763 3:37760448-37760470 TGTCCCACAAAGCACACCAAAGG - Intronic
954235855 3:49256664-49256686 AGCCTCACAGCTCACATCATTGG + Exonic
954387746 3:50253181-50253203 AGCCCCTCAGAGCACTCACTAGG - Exonic
954794379 3:53154173-53154195 ACACCCACAGAGCACACCCACGG + Intergenic
959336074 3:105066656-105066678 AGGCCCACAGAGTACTCCCTGGG - Intergenic
960490737 3:118314044-118314066 AGGCCCACAGTGTACACCTTGGG - Intergenic
961963743 3:130880739-130880761 AGTCCCACTGAGCATACTATGGG - Intronic
968075809 3:195815697-195815719 TGCCCCTCAGAGCGCCCCATGGG + Intergenic
969558489 4:7930203-7930225 AGACGCACAGGGCACACCACGGG + Intronic
972640180 4:40918293-40918315 AGGCCCACAAAGAACTCCATAGG + Intronic
974039444 4:56845194-56845216 GGCCCCAGAGAGCACAGCAGAGG - Intergenic
975668794 4:76759497-76759519 AGCCACACAGATCACGCCAGAGG - Intronic
982705195 4:158701378-158701400 AGGACCACAGAGCAGACAATGGG - Intronic
983081389 4:163389433-163389455 AGCCCCACAGACAATACAATAGG - Intergenic
983780550 4:171665432-171665454 AGCCCCACAGCCCCCACCAGCGG - Intergenic
985559603 5:576643-576665 AGCACCACAGACCATACAATGGG + Intergenic
985590392 5:761507-761529 AGGGCCACAGGGCACACCTTGGG + Intronic
992952979 5:81878829-81878851 AGCCCCACAGGGCACACAGCGGG + Intergenic
996332561 5:122346399-122346421 AGCCACACAGAGCAAATCACAGG - Intronic
997526087 5:134554186-134554208 ATCCCCACAGATCACCCTATTGG - Intronic
998452651 5:142246711-142246733 AGCCCCCCAGAAAACACCAGAGG + Intergenic
1001564405 5:172690090-172690112 GGCCCAGAAGAGCACACCATGGG - Exonic
1002373731 5:178774231-178774253 AACCCAACAGAGCTCACCAGGGG + Intergenic
1002533492 5:179863403-179863425 AGCCCCACTGATGACACCTTGGG + Exonic
1002984434 6:2175010-2175032 GGCCACACAGACCACACCAGAGG + Intronic
1006671024 6:35729759-35729781 AGCCCCATAGAGTCCACCTTTGG + Intergenic
1007388905 6:41538524-41538546 AGTCCCACAGAGGAAACCCTGGG + Intergenic
1012249491 6:96963999-96964021 AGCCCCACATAGCACTCCCCTGG + Intronic
1013659567 6:112281281-112281303 AGGACCACAGAGCAGAACATGGG - Intergenic
1017662593 6:156688268-156688290 AGCCCTCCAGGGTACACCATAGG + Intergenic
1018815172 6:167325139-167325161 AGACCCACAGAGGCCACCCTCGG + Exonic
1019576067 7:1738192-1738214 AGCACCACAGGCCACGCCATGGG - Intronic
1020966253 7:14872357-14872379 ATCTCCGCAGAGCACACTATAGG + Intronic
1022625011 7:32026243-32026265 AGCCCCACAGCCTACACAATAGG + Intronic
1023358999 7:39396796-39396818 AGCCCCACAGACAGCAGCATGGG - Intronic
1024243865 7:47455033-47455055 AGCCCCTCAGGGCACAGCACAGG + Intronic
1024686741 7:51754072-51754094 AGCCCCGCAGGGCTCAGCATTGG + Intergenic
1025013137 7:55415355-55415377 AGCCCCAGAGAGAACTGCATTGG + Intronic
1026473110 7:70711126-70711148 ACCCCCCCAGAGCACACCTTCGG + Intronic
1029223667 7:99009398-99009420 TGGGCCACAGAGTACACCATGGG - Intronic
1032477912 7:132224962-132224984 AGTTCCACAGAGCAAACCGTGGG - Intronic
1032522263 7:132554325-132554347 TCCACCACATAGCACACCATGGG - Intronic
1034539278 7:151745818-151745840 GGCCCCACCGAGCCCTCCATGGG - Intronic
1035173928 7:157037198-157037220 AGCCCCACAGAGGACACTCTTGG + Intergenic
1037824854 8:22155071-22155093 GGCCCCACAGTGCCCACCTTGGG + Intronic
1039864637 8:41490450-41490472 AGCCCCACAGCGCGCAGCTTCGG + Intronic
1040543937 8:48382243-48382265 AGGCCCACAGAGCCCCCCAGTGG - Intergenic
1045193336 8:99904908-99904930 AACCACACAGGGCACACCATCGG - Intergenic
1047564654 8:126030700-126030722 AGCCCCACATACCTCACCACAGG - Intergenic
1048621094 8:136133694-136133716 TTCCCCTGAGAGCACACCATTGG + Intergenic
1049674924 8:143885115-143885137 CGCCCCACAGTGCTCACCACGGG - Intergenic
1049679999 8:143913882-143913904 GGCCCCACAGAGGACCGCATGGG + Intergenic
1052790281 9:32869316-32869338 AGCCCCACAAACCACAGCAATGG + Intergenic
1057423117 9:94927855-94927877 TGGCCCAGTGAGCACACCATGGG + Intronic
1058266266 9:102902471-102902493 AGCACCACATAGCACATAATTGG + Intergenic
1058681719 9:107446096-107446118 AAACCCACATAGCACATCATGGG + Intergenic
1061093934 9:128443486-128443508 TGCCCCACACAGGCCACCATAGG - Intergenic
1062203659 9:135322691-135322713 AGGACCACAGAGCACCCCAGGGG + Intergenic
1062679795 9:137772790-137772812 GGCCCCACTGAGGTCACCATGGG - Intronic
1187378439 X:18778582-18778604 AGCCCCAAGGAGCTGACCATAGG + Intronic
1189992634 X:46609221-46609243 AGCACCACAGAGGAAACCCTGGG + Intronic
1192054558 X:67760065-67760087 ATCTCCACATAGCTCACCATTGG - Intergenic