ID: 1076758410

View in Genome Browser
Species Human (GRCh38)
Location 10:132587392-132587414
Sequence CAGCCCCACAGAGCACACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 295}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076758410_1076758414 -10 Left 1076758410 10:132587392-132587414 CCATGGTGTGCTCTGTGGGGCTG 0: 1
1: 0
2: 5
3: 46
4: 295
Right 1076758414 10:132587405-132587427 TGTGGGGCTGGCAGGGATCCTGG No data
1076758410_1076758420 28 Left 1076758410 10:132587392-132587414 CCATGGTGTGCTCTGTGGGGCTG 0: 1
1: 0
2: 5
3: 46
4: 295
Right 1076758420 10:132587443-132587465 TCGAGGTCAGAAATCATGACGGG No data
1076758410_1076758415 -5 Left 1076758410 10:132587392-132587414 CCATGGTGTGCTCTGTGGGGCTG 0: 1
1: 0
2: 5
3: 46
4: 295
Right 1076758415 10:132587410-132587432 GGCTGGCAGGGATCCTGGCATGG No data
1076758410_1076758421 29 Left 1076758410 10:132587392-132587414 CCATGGTGTGCTCTGTGGGGCTG 0: 1
1: 0
2: 5
3: 46
4: 295
Right 1076758421 10:132587444-132587466 CGAGGTCAGAAATCATGACGGGG No data
1076758410_1076758417 11 Left 1076758410 10:132587392-132587414 CCATGGTGTGCTCTGTGGGGCTG 0: 1
1: 0
2: 5
3: 46
4: 295
Right 1076758417 10:132587426-132587448 GGCATGGCCTGTGTGATTCGAGG No data
1076758410_1076758419 27 Left 1076758410 10:132587392-132587414 CCATGGTGTGCTCTGTGGGGCTG 0: 1
1: 0
2: 5
3: 46
4: 295
Right 1076758419 10:132587442-132587464 TTCGAGGTCAGAAATCATGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076758410 Original CRISPR CAGCCCCACAGAGCACACCA TGG (reversed) Intronic
900427677 1:2587870-2587892 CAGCACCACAGAGGGCAGCAGGG - Intronic
900464796 1:2820518-2820540 CAGGCCCACACTGCACACCTAGG - Intergenic
900652064 1:3734604-3734626 AAGCCCCTCAGGGCACAGCAAGG + Exonic
901813431 1:11780446-11780468 GACCCCCACAGGGCACACCCAGG + Intronic
902176987 1:14657752-14657774 CATCCCCCCAGAGCACAGCCTGG + Intronic
902734815 1:18393331-18393353 CAGGCACACAGAGCCCACCGTGG + Intergenic
902885619 1:19402703-19402725 GAGCACCACAGAGGACACCGTGG - Intronic
903601211 1:24542138-24542160 CAGCCCCACAGAACACAGCTTGG - Intergenic
903665710 1:25006297-25006319 CAGGCCCTCAGAGCACGGCAGGG + Intergenic
903970900 1:27118217-27118239 CAGGCCCAGAGAGCCCATCAGGG - Intronic
905920706 1:41716777-41716799 CAGCCCCTCTGAGCTCCCCACGG - Intronic
906791282 1:48660524-48660546 CAGCCCCACAGGGCACAGCTGGG - Intronic
906792155 1:48668497-48668519 CAGCCCCAGCTAGCACTCCATGG + Intronic
907277545 1:53325715-53325737 CAGCCCCACACTGCACAGGAAGG - Intronic
907499156 1:54865851-54865873 CAGCCCCTCAGTGCAACCCAGGG + Intronic
911227272 1:95319733-95319755 CAGCTCCACAGGTCACACGAGGG - Intergenic
913080452 1:115380231-115380253 CGGCCCAGCAGAGCAGACCAGGG - Intergenic
915554371 1:156653178-156653200 CAGCCCCACAGAGCATCCTCAGG + Intronic
915587824 1:156853827-156853849 CAGCAGCACCCAGCACACCAGGG + Exonic
915607062 1:156959092-156959114 GAGCTTCACAGAGAACACCACGG + Exonic
915917971 1:159952446-159952468 CTTCTCCACAGAGCACACCAGGG + Exonic
916141936 1:161707309-161707331 GGGCCACCCAGAGCACACCAAGG - Exonic
920651486 1:207840553-207840575 GGGCCCCACAGAGGCCACCAGGG + Intergenic
922712705 1:227845387-227845409 CTGCCCCACAGTGGACACCAAGG - Intronic
922739085 1:228005743-228005765 TATCCCCAGAGAACACACCACGG + Intergenic
922964833 1:229680208-229680230 TAGCCACAAAGAGCCCACCATGG - Intergenic
923032605 1:230262172-230262194 CGGGGCCACAGAGCACAGCAAGG - Intronic
924296010 1:242587163-242587185 CACCACCACAGAGCCCAGCAAGG + Intergenic
1063122993 10:3117713-3117735 CAGCCCCAGAACGCACACCGAGG - Intronic
1063565871 10:7171970-7171992 CACCCCCAGAGAGGACACGAAGG - Exonic
1063651862 10:7946043-7946065 CAGCCCCACAGAGGAGGCCAAGG - Intronic
1063769371 10:9180440-9180462 CTGCCCCCCTGAGCACAGCAAGG + Intergenic
1064142465 10:12802246-12802268 CAGCCTCACAGAGCCCTGCAAGG + Intronic
1066211722 10:33246601-33246623 CACACACACAGAGCACACCTGGG + Intronic
1066441812 10:35446750-35446772 CAGCCCCACAGATCCCACAAGGG - Intronic
1067295084 10:44971130-44971152 CAGCCCCACAGAGCCCAGCTTGG + Intronic
1067552136 10:47243643-47243665 CAGTCCCACGGAGCCCAACAAGG + Intergenic
1070657023 10:78278674-78278696 CAGCCCCTGAGAGCAGAACAGGG - Intergenic
1071325580 10:84513481-84513503 CAGACCCACAGATCACACCCAGG + Exonic
1075474740 10:122724456-122724478 CACCCCCACAGACCCCACCCAGG + Intergenic
1075820159 10:125300738-125300760 CAGCCCCCCAGGGCACAATAAGG - Intergenic
1075878465 10:125827908-125827930 CAGCGGCACAAAGCTCACCATGG - Intronic
1076337457 10:129717938-129717960 CAGCCCCGCAGACCAGAGCAAGG - Intronic
1076758410 10:132587392-132587414 CAGCCCCACAGAGCACACCATGG - Intronic
1076810971 10:132886141-132886163 CAGCCCCACAGTGGCCACCCGGG + Intronic
1077208125 11:1353780-1353802 CACCCCCAGAGAGGTCACCATGG + Intergenic
1077240425 11:1507818-1507840 CAGCTTCACAGAGCCCAGCAGGG + Intergenic
1078487609 11:11738551-11738573 CAGCCCCAGAAAGGACATCAAGG - Intergenic
1078533736 11:12156715-12156737 CATCCCCACAGAGCCCACCATGG - Intronic
1079097340 11:17519330-17519352 CAGCTCCACAAAGCACAGGATGG - Intronic
1080226417 11:29966218-29966240 AACCCCCAGAGAGCACACCTAGG - Intergenic
1080569724 11:33544965-33544987 CTGGCCCAAAGAGGACACCAGGG + Exonic
1082996633 11:59260865-59260887 CAGCCCCACCAAGCACCCCATGG - Intergenic
1083321696 11:61851626-61851648 CAGTCCCACACACCACAGCAGGG + Intronic
1083328832 11:61887456-61887478 GAGCCCCAGAGAGCACAGCAGGG - Intronic
1083459696 11:62802814-62802836 CTGCCCCTCAGAGAACTCCAGGG + Intronic
1084325623 11:68398278-68398300 CTGCCCCTCAGAGCACAGCTAGG + Intronic
1085412930 11:76302242-76302264 AGGCCCCAAAGTGCACACCACGG - Intergenic
1086090034 11:82996330-82996352 CAGGCTCACAGAGCAAGCCAGGG + Intronic
1087381334 11:97408762-97408784 CAGCCCCAGGCAGCACAGCAAGG + Intergenic
1087766285 11:102158535-102158557 CAGCAGCACTGAGCACACCCAGG - Intronic
1090189945 11:124760956-124760978 CAGCCCCCCAGGCCACACCAAGG - Intronic
1090581666 11:128167013-128167035 TAGCCTCCCAGAGCACACAAAGG - Intergenic
1090868090 11:130719741-130719763 CAGCCCCTCCAAGCACACAAAGG - Intergenic
1092731536 12:11539629-11539651 CAACCCCAAATAGCACAACATGG + Intergenic
1093479395 12:19589371-19589393 CATCCCCACAGAGCTTTCCAAGG - Intronic
1095991172 12:48035624-48035646 CAGGCCCACAGAGCACTAGAAGG - Intergenic
1097451522 12:59742338-59742360 CAGCCCCACCTAGGCCACCAGGG - Intronic
1098243046 12:68487841-68487863 CAGCCCCACTGAGGACCCGATGG - Intergenic
1099697623 12:86041891-86041913 ACGCCCCACAGAGCACATTAGGG - Intronic
1100089756 12:90954966-90954988 CAGTCCCACCCAGCACACCTGGG - Exonic
1100854162 12:98743575-98743597 CAGCCCCATAGACCAGAGCAGGG - Intronic
1101756392 12:107623865-107623887 CACCCCCAGAGACCATACCATGG - Intronic
1102743505 12:115229407-115229429 GAGCCACCCAGATCACACCACGG - Intergenic
1103732068 12:123034324-123034346 CAGGCGCACAGAGCACACCATGG - Intronic
1103949326 12:124542601-124542623 CAGACCCACAGATCAGACCCTGG + Intronic
1103949424 12:124542981-124543003 CAGCCACCCAGAGTTCACCAAGG + Intronic
1104656032 12:130574727-130574749 CAGCCCCACCGCCCACCCCAGGG + Intronic
1104704702 12:130934322-130934344 CAGCTCCACAGAGCACAGGAAGG - Intergenic
1105587239 13:21756546-21756568 CAGCACCACAGACCTCACCATGG - Intergenic
1108514494 13:51187326-51187348 CTTCTCCACAGAACACACCACGG + Intergenic
1110592655 13:77282685-77282707 CAGCCCTACATAGCACACACTGG + Intronic
1111421051 13:88011329-88011351 CAGCCCCAGGCAGTACACCATGG - Intergenic
1113424618 13:110197810-110197832 GGGCCCCACAGAGCACACGTTGG + Intronic
1114435088 14:22699593-22699615 CAGTTACACAGAGCACAGCATGG - Intergenic
1114640342 14:24215559-24215581 CAGCCGCACCGGGCACCCCAAGG + Exonic
1115507303 14:34104722-34104744 CAGACCCACAGAGAGCACCAAGG + Intronic
1115906718 14:38209586-38209608 CAGCCCCACCAGGCACACCACGG - Exonic
1118443187 14:65830040-65830062 TGGGCCCACAGAGCAGACCATGG + Intergenic
1119646774 14:76354073-76354095 CAGCCACACAAAGCTCAGCAGGG - Intronic
1119726088 14:76922591-76922613 CAGCCCCTCAGAGCCCACTGAGG + Intergenic
1119816885 14:77577482-77577504 CAGCCCAACATGTCACACCATGG + Intronic
1120565344 14:86048262-86048284 CCACCCCACAGAGCCCAGCAAGG - Intergenic
1122236520 14:100333480-100333502 CAGCACCACTAAGCACCCCACGG + Intergenic
1122325632 14:100879472-100879494 CACCCCCACTGAGGCCACCAGGG - Intergenic
1122640173 14:103155333-103155355 CAGAGGCACAGAGCGCACCAAGG + Intergenic
1125956563 15:43794565-43794587 CAGAACCACAGAACAAACCAGGG - Exonic
1128087686 15:64897291-64897313 CAGCCCCACACAGGATGCCATGG + Intronic
1128463659 15:67890542-67890564 CAGCCCCAATGAGCACAGGAGGG - Intergenic
1128576643 15:68780533-68780555 AAGCCACACAGAGCACAAAAAGG + Intronic
1129713210 15:77832074-77832096 CAGCTCCAGAAAGCACACCCAGG + Intergenic
1130298632 15:82664244-82664266 CAGCCCCACCCAGCTCACGAGGG + Intronic
1130328595 15:82901737-82901759 TAGCTCCACAGAGCACATTAGGG - Intronic
1131200572 15:90392448-90392470 AAGCTCCACAGAGCACAAGATGG - Intronic
1131372522 15:91894584-91894606 CAGCCCCACTGTCCACTCCATGG - Intronic
1132668203 16:1091352-1091374 CTGCCACAAATAGCACACCAAGG + Intronic
1132951863 16:2567335-2567357 CACCCCCACAGAGCCCTCTATGG - Intronic
1132962487 16:2632835-2632857 CACCCCCACAGAGCCCTCTATGG + Intergenic
1133087107 16:3373416-3373438 CAGGGACACAGAGCACATCAGGG - Intronic
1133885803 16:9826415-9826437 CAGCTCATCTGAGCACACCATGG + Intronic
1134527966 16:14958883-14958905 CTGCTCCACAAAGAACACCATGG - Intergenic
1134719349 16:16372102-16372124 CCGGCCCACAGAGCTCACCCCGG - Intergenic
1134784684 16:16930872-16930894 CAGGCCCACAAAGCACATCAAGG + Intergenic
1136366417 16:29811254-29811276 CAGCCTCACAGGGCAGAGCAAGG - Intronic
1137396325 16:48118141-48118163 CAGCCCCACAGCGGTCCCCAGGG + Intronic
1137828084 16:51516997-51517019 CACCCCTACAGAGCCCAGCAAGG + Intergenic
1139275663 16:65725376-65725398 CACCCCCACCGAGCACAGCCAGG + Intergenic
1139539029 16:67599973-67599995 CAGCCCCCCTGAGCACACCAAGG - Intronic
1139651840 16:68366095-68366117 CAGACCCAAAAAGCACTCCAGGG + Intronic
1140134487 16:72193678-72193700 CATCCCCAGAGAGCACTGCAAGG - Intergenic
1140141643 16:72264011-72264033 CAGCCACACAGAGCAGAACAGGG - Intergenic
1141932792 16:87217050-87217072 CAGCCCCTCAGTGGGCACCAGGG - Intronic
1142178077 16:88654120-88654142 CACCCCCACAGAGCAGCGCAGGG + Intronic
1142255871 16:89013694-89013716 CAGCCGCCCAGAGAACCCCATGG - Intergenic
1142307938 16:89295846-89295868 CACCTGCACAGAGCACCCCAAGG - Intronic
1142694477 17:1626202-1626224 CAGCCTGAAAGAGCCCACCAGGG + Intronic
1143122448 17:4617316-4617338 CAGAGCCACAGCGCAAACCACGG + Intergenic
1144040645 17:11407786-11407808 CATCCCCAGAGAGCACAGGAGGG - Intronic
1144507437 17:15844529-15844551 CGTCTCCACAGAGCACAACAAGG - Intergenic
1146468715 17:33107731-33107753 CATCAACACAGAGGACACCAAGG - Intronic
1146594357 17:34156368-34156390 CAGGCCCAGAGAGCCCACGAAGG + Intronic
1147598373 17:41731292-41731314 CAGCCCCACTGATCTCTCCAGGG - Intronic
1147886712 17:43689098-43689120 CACACACACAGTGCACACCACGG - Intergenic
1148779437 17:50113127-50113149 GAGCTCCACAGAGTACACCTGGG - Intronic
1148875494 17:50684572-50684594 CAGCTCCCCAGAGGACACAATGG - Intronic
1152221984 17:79073895-79073917 GGGCCCCACAGGGCAAACCAAGG - Intergenic
1152738128 17:82007445-82007467 CAGGCCCACAGCCCACACCAGGG - Intronic
1152837703 17:82544920-82544942 CAGAGCAACAGAGCACACCATGG - Intronic
1152987022 18:330353-330375 CAGCCCCAGAGGCCACACCGTGG + Intronic
1153469234 18:5425139-5425161 CTTCCCCAAAGAGCACACAATGG + Intronic
1153699433 18:7677859-7677881 AAGTCCCACACAGCAAACCAGGG - Intronic
1154411650 18:14145098-14145120 CAGCCCCTCAGAGAATAACAGGG + Intergenic
1156010124 18:32487393-32487415 CAGCCTCTCAAAGCACATCATGG + Intergenic
1156312706 18:35939424-35939446 CAGCCTCACAGAGCAGAGCAGGG + Intergenic
1159464440 18:68762966-68762988 CAGCCTCACAAACCACACAAAGG + Intronic
1159939524 18:74396089-74396111 CAGGCACACAGAGTACACCCAGG + Intergenic
1160231267 18:77051452-77051474 CTGCCCGACAGAGCCCACCTGGG + Intronic
1160768730 19:821206-821228 CAGCCCCTCTGACCACACCTTGG + Intronic
1161041176 19:2111486-2111508 CAGGACCACACAGCCCACCACGG + Intronic
1161124942 19:2550593-2550615 AAGCCCCTCAGAGCCCAGCAGGG - Intronic
1161261466 19:3340128-3340150 CAGCCCCACAGAGCCCACGGAGG - Intergenic
1161389951 19:4015676-4015698 CAGCACCACAGAGTGCACCCTGG - Intronic
1162529404 19:11227361-11227383 CAGGCCCACAGAGCCCACCAAGG + Exonic
1164637593 19:29802719-29802741 CAGGCACACAGAACCCACCACGG + Intergenic
1165761748 19:38325781-38325803 AAGCCCCACAGGGTCCACCAGGG - Intronic
1165781180 19:38435015-38435037 CAGCCCCTCAGCAGACACCATGG + Intronic
1166258527 19:41621879-41621901 CAGCCCAACAGACCACACTCAGG - Intronic
1166367002 19:42282931-42282953 GGGAACCACAGAGCACACCATGG - Intronic
1166792856 19:45408294-45408316 CAGCCCCCCAGGGCACCCTAAGG + Exonic
925170125 2:1745010-1745032 AAGCCCCAAAGCGCACAGCAAGG + Intergenic
926276145 2:11404728-11404750 CAGCCCCTCAGAGCAGACCCAGG + Intergenic
926369760 2:12168052-12168074 CAGCCCCCAAGAGTAAACCAAGG + Intergenic
926929751 2:18024873-18024895 CATCCCCACACAGCCCACCTAGG + Intronic
927154483 2:20213624-20213646 CTGCCCTAAAGAGCCCACCAAGG + Intronic
927844226 2:26463206-26463228 AAGCCCCACACAGCACACTCCGG - Intronic
930599741 2:53429242-53429264 AAGCCCAACTGAGCACAGCAGGG + Intergenic
931114053 2:59145294-59145316 GATCCCCACAGAGCACAGCGTGG + Intergenic
932912547 2:75820337-75820359 CAGCCTCACCTAGCTCACCAGGG + Intergenic
933760172 2:85667258-85667280 GAGGCCAACAGAGCACTCCAAGG + Intronic
933898839 2:86835085-86835107 CAGCCCCACCCAGCACAGAAAGG - Intronic
934719552 2:96564140-96564162 CAGTGCCACAGTGCCCACCATGG + Intergenic
934992532 2:98931610-98931632 CAGCCCCACACACCACAGCCAGG + Intronic
935293406 2:101628253-101628275 CAGCCCCATAAGGCACAACACGG - Intergenic
935709862 2:105888795-105888817 CAGCCCTACAGAGCCCCCTAGGG + Intronic
935781708 2:106514140-106514162 CAGCCCCACCGAGCACAGAAAGG + Intergenic
936154869 2:110040977-110040999 CAGACTCACAGAGCAGGCCAGGG - Intergenic
936189813 2:110330437-110330459 CAGACTCACAGAGCAGGCCAGGG + Intergenic
942554936 2:177162260-177162282 CAGCCCAACAGAGCACACTAAGG + Intergenic
943075181 2:183185872-183185894 CAGCTCCAGAGAGCACACACTGG - Intergenic
946188599 2:217995645-217995667 CGGCCTCACGGAGCACACCCCGG + Intronic
946248172 2:218398837-218398859 CAGACCCACGGCGCGCACCACGG + Intronic
947670138 2:231930606-231930628 CAGCCCCTCAGAGCACACAGAGG + Intergenic
947862688 2:233373050-233373072 CACGCGCACAGAGCACAGCACGG - Intronic
947925622 2:233919972-233919994 CTGGCCCACAGATCACACCAAGG - Intronic
947952309 2:234158998-234159020 CAGACCCAGAGAACACAGCAGGG - Intergenic
948685941 2:239669838-239669860 CAGCCCCACAGGGCACTAGAGGG - Intergenic
948983584 2:241507550-241507572 CAGCCCCTCAGCGCCCGCCAGGG + Intronic
1169970186 20:11261604-11261626 CACCTCCTCAGAGCAGACCAGGG + Intergenic
1170392663 20:15892128-15892150 CAGCCTCCCAGAGCACAGCAGGG + Intronic
1170627231 20:18039044-18039066 CAGACCCAAAGAGCACACTATGG + Intronic
1171252997 20:23663519-23663541 CAGCCCCACCCAGCACACACAGG - Intergenic
1171424989 20:25043513-25043535 CAGCCCAGCACAGCACACCCAGG + Intronic
1172011561 20:31848826-31848848 GGGCCCCACACAGCACCCCAAGG - Intronic
1172783579 20:37451523-37451545 CAGCCACATTGAGCCCACCATGG + Intergenic
1172957430 20:38771080-38771102 CAGCCTCACAGAGAACGCCCAGG + Intronic
1172968756 20:38858295-38858317 CAGCACCACAGAGAACCCCAGGG - Intronic
1173918314 20:46725842-46725864 AAGCCCCACAGAGGCCAGCACGG - Exonic
1174545136 20:51319506-51319528 CAGCCCCACAGACCACTCTCAGG + Intergenic
1174667200 20:52270889-52270911 CAGGCCCAAAGAGCACACTGAGG + Intergenic
1175279466 20:57793500-57793522 CAGCCCCGCAGACCCCTCCAGGG - Intergenic
1175980400 20:62735804-62735826 CAGCCCCACAGGTCACAGCGGGG - Intronic
1176248833 20:64110375-64110397 CTGCCCAACAGAGCTGACCACGG - Intergenic
1176285182 21:5015688-5015710 CAGCCCCACAGAGCCTGGCATGG - Intergenic
1176861411 21:14013329-14013351 CAGCCCCTCAGAGAATAACAGGG - Intergenic
1178007091 21:28234257-28234279 CACTCCCACAGAGCCCAGCAAGG + Intergenic
1178702457 21:34845150-34845172 GACTCCCACAGAGCACAGCATGG + Intronic
1179543100 21:42096696-42096718 CAGCCCCCCAGCCCACACCCAGG - Intronic
1179730936 21:43367049-43367071 CAGCCCATCAGAGGACACAAAGG + Intergenic
1179871999 21:44247787-44247809 CAGCCCCACAGAGCCTGGCATGG + Intronic
1179967613 21:44816606-44816628 GAGGCCGACAGTGCACACCAAGG + Intronic
1180039964 21:45270853-45270875 GAGCGCCACAGAGCACCCCGTGG + Intronic
1180043571 21:45292689-45292711 CAGCCCCGCCAAGCACAGCATGG + Intergenic
1180071487 21:45438899-45438921 CCGGCCCCCAGACCACACCAGGG - Intronic
1180698451 22:17769138-17769160 GAGCCTCACAGAGCACAGCAGGG + Intronic
1180703548 22:17794858-17794880 CAGAACCACAGAGCACACACAGG + Intronic
1181808073 22:25387003-25387025 GAACCCCACGGAGCCCACCAGGG + Intronic
1182064535 22:27421049-27421071 CAGCCAGACAGAAAACACCACGG + Intergenic
1183390961 22:37545639-37545661 CAGCCCCTTAGGGCACAACATGG - Intergenic
1183663437 22:39234472-39234494 CACCTCCACACAGCACCCCATGG + Intronic
1184090534 22:42290791-42290813 CAGCCTCCCAGAGCACACAGGGG + Intronic
1184240668 22:43209893-43209915 CAGCCCCTCAGAGTCCACCTGGG - Intronic
1184380617 22:44143006-44143028 CAGCCCCCGAGAGCACCCCAGGG + Intronic
1185081266 22:48710638-48710660 CAAGCCCACAGGGCCCACCACGG + Intronic
1185315205 22:50175986-50176008 CAGCCCCAAAGAGCAGCCCCAGG - Intronic
950414640 3:12861951-12861973 CAGCCCCACTGAGCTCTCAAAGG + Intronic
950764964 3:15266772-15266794 TGGCCTAACAGAGCACACCAGGG + Intronic
950952165 3:17011820-17011842 CAGCACTACAAAGCGCACCATGG - Exonic
952967321 3:38629336-38629358 TGGCCCCACAGAGCTCTCCAAGG - Intronic
953827338 3:46265283-46265305 GAGGCCCACAGTGAACACCAGGG - Exonic
954074077 3:48164098-48164120 TAGCCCCACAGATCAGACTAAGG + Intronic
956734365 3:72226542-72226564 CAGTCCCACTGAAAACACCAGGG - Intergenic
961816885 3:129555704-129555726 GAAGCCCACAGAGCACCCCATGG + Exonic
962120852 3:132558422-132558444 GAGGCCCACACAACACACCAGGG + Exonic
962588171 3:136862608-136862630 CAGCCCGACACAGCGCTCCAGGG - Intronic
963236159 3:142958943-142958965 CAGCCCCAGAGACCAACCCACGG + Intronic
963653370 3:148013922-148013944 CAGCCCCAAACATAACACCAGGG + Intergenic
963657374 3:148073954-148073976 CAGCCACACACGGGACACCAGGG - Intergenic
964657355 3:159082594-159082616 CAGCCACACAGGACACACAAAGG - Intronic
964776632 3:160286488-160286510 TGGGCCCACAGAGCACACAATGG + Intronic
966888731 3:184391019-184391041 CAGCCCCACAAATCCCACCTCGG - Intronic
967905262 3:194494243-194494265 CAGCCCCTCACAGCACACAGCGG + Exonic
968075808 3:195815696-195815718 CTGCCCCTCAGAGCGCCCCATGG + Intergenic
968471594 4:785046-785068 CAGACGGACAGAGGACACCACGG + Exonic
968551236 4:1224401-1224423 CAGCCTCACACAGCACACATGGG - Intronic
968795368 4:2700228-2700250 GAGGCCCACAGAGCCCCCCAAGG + Exonic
968891671 4:3372577-3372599 CGGCCACACAGGGCACACCTGGG - Intronic
968980184 4:3843775-3843797 AAGCCTCACAGAGCACACACTGG + Intergenic
969228177 4:5812485-5812507 CAGCCCCACACACCACAGCCAGG + Exonic
969558488 4:7930202-7930224 GAGACGCACAGGGCACACCACGG + Intronic
972636338 4:40887136-40887158 CACCCCCACTGAGCCCCCCAGGG - Intronic
981106832 4:140891406-140891428 CAGGTCCACAGAGCACCCCAAGG + Intronic
982705196 4:158701379-158701401 CAGGACCACAGAGCAGACAATGG - Intronic
985590391 5:761506-761528 CAGGGCCACAGGGCACACCTTGG + Intronic
985619643 5:947476-947498 CAGCCCCGCAGGTCACACCCCGG + Intergenic
985712518 5:1437530-1437552 CAGCCCCGCAGTGCACCCCAGGG - Intronic
985780553 5:1868670-1868692 CAGCCCCTGAGACCACTCCAGGG - Intergenic
986626233 5:9725678-9725700 CAGCCCCACCGACCACCCAAGGG + Intergenic
986642682 5:9888019-9888041 CAGCCCCGCTGAGAGCACCAGGG + Intergenic
988618203 5:32795225-32795247 CACCCCCACAGAGCCCAGCAAGG + Intergenic
990652814 5:57921887-57921909 CAGCCCAGAAGAGGACACCAGGG - Intergenic
991860906 5:71012363-71012385 CAGCCTCTGAGAGCACACAAGGG + Exonic
992952978 5:81878828-81878850 CAGCCCCACAGGGCACACAGCGG + Intergenic
996073471 5:119161513-119161535 CAGCCCCAGACCTCACACCAAGG - Intronic
997391427 5:133520347-133520369 CAACCATCCAGAGCACACCACGG + Intronic
997827365 5:137118493-137118515 CTCCCCCACAGGGGACACCAAGG + Intronic
999237321 5:150106652-150106674 CAGCTCCATAGAGCAGATCAAGG + Intronic
999239856 5:150121118-150121140 CATCCTCCAAGAGCACACCAGGG - Intronic
999887286 5:155937133-155937155 CAGCCCCAAAGAGCACAGAGAGG + Intronic
1001284570 5:170413160-170413182 GAGCACCAGAGAGCAGACCAAGG + Intronic
1002373730 5:178774230-178774252 CAACCCAACAGAGCTCACCAGGG + Intergenic
1002421474 5:179151490-179151512 CAGCCCCACTGAGACCACCTTGG - Intronic
1002533491 5:179863402-179863424 CAGCCCCACTGATGACACCTTGG + Exonic
1003349651 6:5303936-5303958 GAGCCACACAGAGCAGTCCACGG - Intronic
1006165396 6:32061679-32061701 CAGCCCCACAGAACCCAGCATGG - Intronic
1006166352 6:32067943-32067965 CAGCCCCACAGAACCCAGCATGG - Intronic
1006781897 6:36637670-36637692 CAACCCAACAGGGCACAACAGGG - Intergenic
1007388904 6:41538523-41538545 CAGTCCCACAGAGGAAACCCTGG + Intergenic
1013108512 6:107046632-107046654 AGGCTCCACAGAGCAGACCAGGG - Intronic
1014180423 6:118378200-118378222 CATCTCAACAGAGCACAGCAGGG - Intergenic
1015984112 6:138868843-138868865 CAGCCCCAAAGAGGACAGCATGG + Intronic
1016304325 6:142667612-142667634 CAGCTCCACAGAACTCCCCAGGG + Intergenic
1017949162 6:159121284-159121306 CAGCCTCCCAGAGCACCCAAGGG - Intergenic
1019010878 6:168842609-168842631 CAGCCCCACACATCACGGCAGGG - Intergenic
1023967254 7:44969459-44969481 CTGCCCCACAGACAAGACCATGG - Exonic
1024738067 7:52327187-52327209 CAGCCTCACAGAATACACCAGGG + Intergenic
1025026615 7:55521721-55521743 CAGCCCCACAGGGCAGGGCAGGG + Intronic
1026844999 7:73693775-73693797 CAGCCCCAGAGTGCAGACCCTGG + Intronic
1029223668 7:99009399-99009421 CTGGGCCACAGAGTACACCATGG - Intronic
1029854822 7:103504792-103504814 CACCCCCACGGAGCCCAGCAAGG + Intronic
1031781673 7:125975630-125975652 CAGTCCCACCGAGCATACAAAGG - Intergenic
1032490132 7:132318258-132318280 GAGCACCAGAGATCACACCAGGG + Intronic
1034164605 7:149015829-149015851 CTGCCCCCCAGACCACACCCAGG + Intronic
1034260043 7:149749587-149749609 CTGCCACACAGAGGACACCTGGG + Intergenic
1034271009 7:149803427-149803449 CAGCCCCAAGGGGCACAGCAGGG - Intergenic
1035189171 7:157150866-157150888 CTGCCCCACAGAACTGACCAAGG - Intronic
1035386226 7:158474865-158474887 CAGTCCCACAGGGCACCCCGTGG - Intronic
1035471110 7:159109448-159109470 GAGCCCCAGAGAGCACACTCTGG - Intronic
1035779589 8:2217137-2217159 CACCCCTACAGAGGGCACCAAGG - Intergenic
1038420370 8:27430561-27430583 CAGCCCCAGAGAGGACCCCTGGG - Intronic
1040710112 8:50177545-50177567 CAGCCTCTCTGAGCAAACCAGGG - Intronic
1042427464 8:68664724-68664746 CATCCACAGAGAGAACACCAGGG + Intronic
1042691427 8:71503814-71503836 CATCCCCACAGACCACAGCAGGG + Intronic
1043269670 8:78316070-78316092 CAGACCCACAGAGCTCTACAAGG + Intergenic
1044899487 8:96928666-96928688 CAGCTCTACAGAGCACAGCCCGG - Intronic
1045502956 8:102757263-102757285 CACCCCCACAGAGCCCAGCAGGG - Intergenic
1046459528 8:114515220-114515242 CAAACCCACAGAGAACATCATGG + Intergenic
1047315373 8:123728122-123728144 CAGCCCAACACAGCACTCAAGGG - Intronic
1048243195 8:132764950-132764972 CTGCCACACATAGCACACAAGGG + Intergenic
1048705715 8:137150723-137150745 CTGCCTCACAGAAAACACCAAGG - Intergenic
1049003709 8:139841783-139841805 CAGCCCCCTAAAGCACCCCAAGG + Intronic
1049128398 8:140813178-140813200 CATTCCCTCAGAGCACAGCATGG + Intronic
1049207597 8:141370710-141370732 CAGCCCCACAGTGGGAACCAAGG + Intergenic
1049316836 8:141973780-141973802 CAGGCCCACAGAGCAGAACAAGG - Intergenic
1049674925 8:143885116-143885138 TCGCCCCACAGTGCTCACCACGG - Intergenic
1049784327 8:144443431-144443453 AACCCCCACAGAGCAGGCCAAGG + Intronic
1050058553 9:1680677-1680699 CAGCCCACCAGAGTACCCCAGGG - Intergenic
1050964958 9:11788238-11788260 AAGCCCAGCACAGCACACCAGGG - Intergenic
1052366174 9:27614672-27614694 CAGCCCACCACAGCTCACCAAGG - Intergenic
1053169430 9:35868204-35868226 CACCCACACAGAACACACCCAGG - Intergenic
1053299041 9:36935839-36935861 GAGCTCCAGAGAGCACACCCAGG - Intronic
1053541378 9:38977314-38977336 CGGGCCCACAGAGCAGACAATGG + Intergenic
1054624760 9:67386594-67386616 CGGGCCCACAGAGCAGACAATGG - Intergenic
1056837746 9:89970993-89971015 CAGGCCCAAAGAGAAGACCAGGG + Intergenic
1057228395 9:93304448-93304470 CAGCACCACTGAGCAGTCCAGGG + Intronic
1061260701 9:129479341-129479363 CAGCCCTACAGAGAAGCCCAGGG + Intergenic
1061415167 9:130443704-130443726 CAGCCCCACGTGGCTCACCAGGG + Intergenic
1061416917 9:130452004-130452026 CAGCCCCACAGACCACACTGGGG - Exonic
1061579123 9:131526072-131526094 CAGCACCTCTGAGCACCCCAGGG - Intronic
1061995313 9:134180182-134180204 CAGCCACAGAGAGGACACCGCGG - Intergenic
1062203658 9:135322690-135322712 TAGGACCACAGAGCACCCCAGGG + Intergenic
1062721995 9:138049531-138049553 CAGGGCCACAGGCCACACCAGGG - Intronic
1186381087 X:9059924-9059946 CAGCCCCAGTGACCACAGCAGGG + Intronic
1187428861 X:19203437-19203459 GTGGCCCACAGAGCCCACCATGG - Intergenic
1189330320 X:40140949-40140971 CAGCCCCTCAGAGTGAACCAGGG - Intronic
1189992633 X:46609220-46609242 CAGCACCACAGAGGAAACCCTGG + Intronic
1190110026 X:47583397-47583419 CTTCCCCACAGAACCCACCATGG + Exonic
1192346734 X:70315576-70315598 CAGTCCCAGAGAGCAGACCAAGG - Intronic
1194012734 X:88582832-88582854 CAGCTCAACAAAGCCCACCACGG - Intergenic
1194165973 X:90516753-90516775 CAGACACACACATCACACCAAGG + Intergenic
1195434704 X:104829054-104829076 CAACCCCACAGAGCCCAGCAAGG - Intronic
1195458152 X:105092849-105092871 CAGGCACACAGGGCACACAATGG - Intronic
1195927429 X:110039687-110039709 CAGGCCAACAGAGCATCCCAGGG - Intronic
1196197023 X:112847238-112847260 CCCTTCCACAGAGCACACCAAGG - Intergenic
1197681906 X:129394136-129394158 CAGCCTCAGAGCCCACACCAGGG + Intergenic
1198002284 X:132451594-132451616 CACCCCCACAGAGCCCAGCAAGG - Intronic
1200512244 Y:4094524-4094546 CAGACACACACATCACACCAAGG + Intergenic
1201931982 Y:19360519-19360541 CACTCCCACAGAGCCCAGCAAGG + Intergenic