ID: 1076758417

View in Genome Browser
Species Human (GRCh38)
Location 10:132587426-132587448
Sequence GGCATGGCCTGTGTGATTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076758410_1076758417 11 Left 1076758410 10:132587392-132587414 CCATGGTGTGCTCTGTGGGGCTG 0: 1
1: 0
2: 5
3: 46
4: 295
Right 1076758417 10:132587426-132587448 GGCATGGCCTGTGTGATTCGAGG No data
1076758409_1076758417 12 Left 1076758409 10:132587391-132587413 CCCATGGTGTGCTCTGTGGGGCT 0: 1
1: 0
2: 2
3: 10
4: 149
Right 1076758417 10:132587426-132587448 GGCATGGCCTGTGTGATTCGAGG No data
1076758405_1076758417 21 Left 1076758405 10:132587382-132587404 CCAGCACAGCCCATGGTGTGCTC 0: 1
1: 0
2: 1
3: 12
4: 163
Right 1076758417 10:132587426-132587448 GGCATGGCCTGTGTGATTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076758417 Original CRISPR GGCATGGCCTGTGTGATTCG AGG Intronic
No off target data available for this crispr