ID: 1076758586

View in Genome Browser
Species Human (GRCh38)
Location 10:132588637-132588659
Sequence TTAGCCTGTGCTGCGTCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076758574_1076758586 13 Left 1076758574 10:132588601-132588623 CCCAGCACAGCGCCCACCCTGTG 0: 1
1: 0
2: 3
3: 36
4: 379
Right 1076758586 10:132588637-132588659 TTAGCCTGTGCTGCGTCTACAGG No data
1076758580_1076758586 -3 Left 1076758580 10:132588617-132588639 CCCTGTGTCCCCAGGAGGCCTTA 0: 1
1: 0
2: 1
3: 20
4: 167
Right 1076758586 10:132588637-132588659 TTAGCCTGTGCTGCGTCTACAGG No data
1076758569_1076758586 20 Left 1076758569 10:132588594-132588616 CCCACCCCCCAGCACAGCGCCCA 0: 1
1: 0
2: 2
3: 76
4: 568
Right 1076758586 10:132588637-132588659 TTAGCCTGTGCTGCGTCTACAGG No data
1076758573_1076758586 14 Left 1076758573 10:132588600-132588622 CCCCAGCACAGCGCCCACCCTGT 0: 1
1: 0
2: 3
3: 29
4: 409
Right 1076758586 10:132588637-132588659 TTAGCCTGTGCTGCGTCTACAGG No data
1076758581_1076758586 -4 Left 1076758581 10:132588618-132588640 CCTGTGTCCCCAGGAGGCCTTAG 0: 1
1: 0
2: 3
3: 17
4: 242
Right 1076758586 10:132588637-132588659 TTAGCCTGTGCTGCGTCTACAGG No data
1076758570_1076758586 19 Left 1076758570 10:132588595-132588617 CCACCCCCCAGCACAGCGCCCAC No data
Right 1076758586 10:132588637-132588659 TTAGCCTGTGCTGCGTCTACAGG No data
1076758575_1076758586 12 Left 1076758575 10:132588602-132588624 CCAGCACAGCGCCCACCCTGTGT 0: 1
1: 0
2: 1
3: 17
4: 231
Right 1076758586 10:132588637-132588659 TTAGCCTGTGCTGCGTCTACAGG No data
1076758568_1076758586 28 Left 1076758568 10:132588586-132588608 CCTGGGTTCCCACCCCCCAGCAC 0: 1
1: 0
2: 4
3: 35
4: 520
Right 1076758586 10:132588637-132588659 TTAGCCTGTGCTGCGTCTACAGG No data
1076758572_1076758586 15 Left 1076758572 10:132588599-132588621 CCCCCAGCACAGCGCCCACCCTG 0: 1
1: 0
2: 5
3: 58
4: 503
Right 1076758586 10:132588637-132588659 TTAGCCTGTGCTGCGTCTACAGG No data
1076758571_1076758586 16 Left 1076758571 10:132588598-132588620 CCCCCCAGCACAGCGCCCACCCT 0: 1
1: 1
2: 3
3: 74
4: 552
Right 1076758586 10:132588637-132588659 TTAGCCTGTGCTGCGTCTACAGG No data
1076758579_1076758586 0 Left 1076758579 10:132588614-132588636 CCACCCTGTGTCCCCAGGAGGCC 0: 1
1: 0
2: 4
3: 55
4: 464
Right 1076758586 10:132588637-132588659 TTAGCCTGTGCTGCGTCTACAGG No data
1076758578_1076758586 1 Left 1076758578 10:132588613-132588635 CCCACCCTGTGTCCCCAGGAGGC 0: 1
1: 1
2: 4
3: 47
4: 472
Right 1076758586 10:132588637-132588659 TTAGCCTGTGCTGCGTCTACAGG No data
1076758567_1076758586 29 Left 1076758567 10:132588585-132588607 CCCTGGGTTCCCACCCCCCAGCA 0: 1
1: 1
2: 1
3: 41
4: 490
Right 1076758586 10:132588637-132588659 TTAGCCTGTGCTGCGTCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076758586 Original CRISPR TTAGCCTGTGCTGCGTCTAC AGG Intronic
No off target data available for this crispr