ID: 1076759455

View in Genome Browser
Species Human (GRCh38)
Location 10:132594511-132594533
Sequence GCGTTTGCATGCCTGTGCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076759449_1076759455 12 Left 1076759449 10:132594476-132594498 CCCACACGCATAGGCATGTGGTG 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1076759455 10:132594511-132594533 GCGTTTGCATGCCTGTGCACGGG No data
1076759450_1076759455 11 Left 1076759450 10:132594477-132594499 CCACACGCATAGGCATGTGGTGA 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1076759455 10:132594511-132594533 GCGTTTGCATGCCTGTGCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076759455 Original CRISPR GCGTTTGCATGCCTGTGCAC GGG Intronic
No off target data available for this crispr