ID: 1076759612

View in Genome Browser
Species Human (GRCh38)
Location 10:132595611-132595633
Sequence TACATTGGGGTGTTTGTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076759604_1076759612 28 Left 1076759604 10:132595560-132595582 CCTACATTCCAGTGTTTGTTGGT 0: 1
1: 0
2: 2
3: 15
4: 190
Right 1076759612 10:132595611-132595633 TACATTGGGGTGTTTGTCACTGG No data
1076759605_1076759612 20 Left 1076759605 10:132595568-132595590 CCAGTGTTTGTTGGTGAGTGTGT 0: 1
1: 0
2: 1
3: 105
4: 2280
Right 1076759612 10:132595611-132595633 TACATTGGGGTGTTTGTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076759612 Original CRISPR TACATTGGGGTGTTTGTCAC TGG Intronic
No off target data available for this crispr