ID: 1076760024

View in Genome Browser
Species Human (GRCh38)
Location 10:132599444-132599466
Sequence GGCGGAGCTGCCCAAGATCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2878
Summary {0: 1, 1: 11, 2: 118, 3: 942, 4: 1806}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076760024_1076760034 24 Left 1076760024 10:132599444-132599466 CCACGATCTTGGGCAGCTCCGCC 0: 1
1: 11
2: 118
3: 942
4: 1806
Right 1076760034 10:132599491-132599513 TCCCTCTCGGCTGCTTTCATGGG No data
1076760024_1076760037 28 Left 1076760024 10:132599444-132599466 CCACGATCTTGGGCAGCTCCGCC 0: 1
1: 11
2: 118
3: 942
4: 1806
Right 1076760037 10:132599495-132599517 TCTCGGCTGCTTTCATGGGCTGG No data
1076760024_1076760033 23 Left 1076760024 10:132599444-132599466 CCACGATCTTGGGCAGCTCCGCC 0: 1
1: 11
2: 118
3: 942
4: 1806
Right 1076760033 10:132599490-132599512 CTCCCTCTCGGCTGCTTTCATGG No data
1076760024_1076760026 -6 Left 1076760024 10:132599444-132599466 CCACGATCTTGGGCAGCTCCGCC 0: 1
1: 11
2: 118
3: 942
4: 1806
Right 1076760026 10:132599461-132599483 TCCGCCCCTGCGGTTCTGCATGG No data
1076760024_1076760031 11 Left 1076760024 10:132599444-132599466 CCACGATCTTGGGCAGCTCCGCC 0: 1
1: 11
2: 118
3: 942
4: 1806
Right 1076760031 10:132599478-132599500 GCATGGTACAGCCTCCCTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076760024 Original CRISPR GGCGGAGCTGCCCAAGATCG TGG (reversed) Intronic
Too many off-targets to display for this crispr