ID: 1076761534

View in Genome Browser
Species Human (GRCh38)
Location 10:132608343-132608365
Sequence CTGTGCAGAGAGTGGGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076761527_1076761534 7 Left 1076761527 10:132608313-132608335 CCTCACCAGGTCCGGTCCGTGCA No data
Right 1076761534 10:132608343-132608365 CTGTGCAGAGAGTGGGTGCTGGG No data
1076761530_1076761534 -9 Left 1076761530 10:132608329-132608351 CCGTGCAGCGCACTCTGTGCAGA 0: 1
1: 0
2: 0
3: 14
4: 127
Right 1076761534 10:132608343-132608365 CTGTGCAGAGAGTGGGTGCTGGG No data
1076761528_1076761534 2 Left 1076761528 10:132608318-132608340 CCAGGTCCGGTCCGTGCAGCGCA 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1076761534 10:132608343-132608365 CTGTGCAGAGAGTGGGTGCTGGG No data
1076761529_1076761534 -4 Left 1076761529 10:132608324-132608346 CCGGTCCGTGCAGCGCACTCTGT 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1076761534 10:132608343-132608365 CTGTGCAGAGAGTGGGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076761534 Original CRISPR CTGTGCAGAGAGTGGGTGCT GGG Intronic
No off target data available for this crispr