ID: 1076761695

View in Genome Browser
Species Human (GRCh38)
Location 10:132608939-132608961
Sequence ACAGAGGTCCCCAGCCCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076761695_1076761705 23 Left 1076761695 10:132608939-132608961 CCAGGAGGGCTGGGGACCTCTGT No data
Right 1076761705 10:132608985-132609007 GCCAGTGCTCCCATGTGGTGAGG No data
1076761695_1076761703 18 Left 1076761695 10:132608939-132608961 CCAGGAGGGCTGGGGACCTCTGT No data
Right 1076761703 10:132608980-132609002 TGCCTGCCAGTGCTCCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076761695 Original CRISPR ACAGAGGTCCCCAGCCCTCC TGG (reversed) Intronic