ID: 1076761698

View in Genome Browser
Species Human (GRCh38)
Location 10:132608955-132608977
Sequence ACACAGGCCCGAGGGCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076761698_1076761705 7 Left 1076761698 10:132608955-132608977 CCTCTGTGCCCTCGGGCCTGTGT No data
Right 1076761705 10:132608985-132609007 GCCAGTGCTCCCATGTGGTGAGG No data
1076761698_1076761703 2 Left 1076761698 10:132608955-132608977 CCTCTGTGCCCTCGGGCCTGTGT No data
Right 1076761703 10:132608980-132609002 TGCCTGCCAGTGCTCCCATGTGG No data
1076761698_1076761709 24 Left 1076761698 10:132608955-132608977 CCTCTGTGCCCTCGGGCCTGTGT No data
Right 1076761709 10:132609002-132609024 GTGAGGCTCCCAGCATGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076761698 Original CRISPR ACACAGGCCCGAGGGCACAG AGG (reversed) Intronic