ID: 1076761699

View in Genome Browser
Species Human (GRCh38)
Location 10:132608963-132608985
Sequence CAGGCAGGACACAGGCCCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076761699_1076761705 -1 Left 1076761699 10:132608963-132608985 CCCTCGGGCCTGTGTCCTGCCTG No data
Right 1076761705 10:132608985-132609007 GCCAGTGCTCCCATGTGGTGAGG No data
1076761699_1076761709 16 Left 1076761699 10:132608963-132608985 CCCTCGGGCCTGTGTCCTGCCTG No data
Right 1076761709 10:132609002-132609024 GTGAGGCTCCCAGCATGCAATGG No data
1076761699_1076761703 -6 Left 1076761699 10:132608963-132608985 CCCTCGGGCCTGTGTCCTGCCTG No data
Right 1076761703 10:132608980-132609002 TGCCTGCCAGTGCTCCCATGTGG No data
1076761699_1076761712 30 Left 1076761699 10:132608963-132608985 CCCTCGGGCCTGTGTCCTGCCTG No data
Right 1076761712 10:132609016-132609038 ATGCAATGGTGCTCTGTAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076761699 Original CRISPR CAGGCAGGACACAGGCCCGA GGG (reversed) Intronic