ID: 1076761701

View in Genome Browser
Species Human (GRCh38)
Location 10:132608971-132608993
Sequence AGCACTGGCAGGCAGGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076761701_1076761705 -9 Left 1076761701 10:132608971-132608993 CCTGTGTCCTGCCTGCCAGTGCT No data
Right 1076761705 10:132608985-132609007 GCCAGTGCTCCCATGTGGTGAGG No data
1076761701_1076761709 8 Left 1076761701 10:132608971-132608993 CCTGTGTCCTGCCTGCCAGTGCT No data
Right 1076761709 10:132609002-132609024 GTGAGGCTCCCAGCATGCAATGG No data
1076761701_1076761712 22 Left 1076761701 10:132608971-132608993 CCTGTGTCCTGCCTGCCAGTGCT No data
Right 1076761712 10:132609016-132609038 ATGCAATGGTGCTCTGTAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076761701 Original CRISPR AGCACTGGCAGGCAGGACAC AGG (reversed) Intronic