ID: 1076761703

View in Genome Browser
Species Human (GRCh38)
Location 10:132608980-132609002
Sequence TGCCTGCCAGTGCTCCCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076761699_1076761703 -6 Left 1076761699 10:132608963-132608985 CCCTCGGGCCTGTGTCCTGCCTG No data
Right 1076761703 10:132608980-132609002 TGCCTGCCAGTGCTCCCATGTGG No data
1076761700_1076761703 -7 Left 1076761700 10:132608964-132608986 CCTCGGGCCTGTGTCCTGCCTGC No data
Right 1076761703 10:132608980-132609002 TGCCTGCCAGTGCTCCCATGTGG No data
1076761698_1076761703 2 Left 1076761698 10:132608955-132608977 CCTCTGTGCCCTCGGGCCTGTGT No data
Right 1076761703 10:132608980-132609002 TGCCTGCCAGTGCTCCCATGTGG No data
1076761695_1076761703 18 Left 1076761695 10:132608939-132608961 CCAGGAGGGCTGGGGACCTCTGT No data
Right 1076761703 10:132608980-132609002 TGCCTGCCAGTGCTCCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076761703 Original CRISPR TGCCTGCCAGTGCTCCCATG TGG Intronic