ID: 1076761712

View in Genome Browser
Species Human (GRCh38)
Location 10:132609016-132609038
Sequence ATGCAATGGTGCTCTGTAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076761701_1076761712 22 Left 1076761701 10:132608971-132608993 CCTGTGTCCTGCCTGCCAGTGCT No data
Right 1076761712 10:132609016-132609038 ATGCAATGGTGCTCTGTAGCCGG No data
1076761707_1076761712 -1 Left 1076761707 10:132608994-132609016 CCCATGTGGTGAGGCTCCCAGCA No data
Right 1076761712 10:132609016-132609038 ATGCAATGGTGCTCTGTAGCCGG No data
1076761700_1076761712 29 Left 1076761700 10:132608964-132608986 CCTCGGGCCTGTGTCCTGCCTGC No data
Right 1076761712 10:132609016-132609038 ATGCAATGGTGCTCTGTAGCCGG No data
1076761702_1076761712 15 Left 1076761702 10:132608978-132609000 CCTGCCTGCCAGTGCTCCCATGT No data
Right 1076761712 10:132609016-132609038 ATGCAATGGTGCTCTGTAGCCGG No data
1076761708_1076761712 -2 Left 1076761708 10:132608995-132609017 CCATGTGGTGAGGCTCCCAGCAT No data
Right 1076761712 10:132609016-132609038 ATGCAATGGTGCTCTGTAGCCGG No data
1076761699_1076761712 30 Left 1076761699 10:132608963-132608985 CCCTCGGGCCTGTGTCCTGCCTG No data
Right 1076761712 10:132609016-132609038 ATGCAATGGTGCTCTGTAGCCGG No data
1076761706_1076761712 7 Left 1076761706 10:132608986-132609008 CCAGTGCTCCCATGTGGTGAGGC No data
Right 1076761712 10:132609016-132609038 ATGCAATGGTGCTCTGTAGCCGG No data
1076761704_1076761712 11 Left 1076761704 10:132608982-132609004 CCTGCCAGTGCTCCCATGTGGTG No data
Right 1076761712 10:132609016-132609038 ATGCAATGGTGCTCTGTAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076761712 Original CRISPR ATGCAATGGTGCTCTGTAGC CGG Intronic