ID: 1076762357

View in Genome Browser
Species Human (GRCh38)
Location 10:132611861-132611883
Sequence GTGTGGGAGGTGAAGTGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076762351_1076762357 -8 Left 1076762351 10:132611846-132611868 CCCCGTCAGAGGAGGGTGTGGGA 0: 1
1: 2
2: 5
3: 31
4: 171
Right 1076762357 10:132611861-132611883 GTGTGGGAGGTGAAGTGGGCAGG No data
1076762353_1076762357 -10 Left 1076762353 10:132611848-132611870 CCGTCAGAGGAGGGTGTGGGAGG 0: 2
1: 2
2: 3
3: 45
4: 369
Right 1076762357 10:132611861-132611883 GTGTGGGAGGTGAAGTGGGCAGG No data
1076762352_1076762357 -9 Left 1076762352 10:132611847-132611869 CCCGTCAGAGGAGGGTGTGGGAG 0: 3
1: 4
2: 13
3: 46
4: 360
Right 1076762357 10:132611861-132611883 GTGTGGGAGGTGAAGTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076762357 Original CRISPR GTGTGGGAGGTGAAGTGGGC AGG Intronic
No off target data available for this crispr