ID: 1076764872

View in Genome Browser
Species Human (GRCh38)
Location 10:132627541-132627563
Sequence CTGGGGACACAGAGGGAGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 575
Summary {0: 1, 1: 0, 2: 4, 3: 61, 4: 509}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076764872_1076764882 20 Left 1076764872 10:132627541-132627563 CCCGACTCCCTCTGTGTCCCCAG 0: 1
1: 0
2: 4
3: 61
4: 509
Right 1076764882 10:132627584-132627606 ATGACAAGTGAAATGAACGAGGG No data
1076764872_1076764881 19 Left 1076764872 10:132627541-132627563 CCCGACTCCCTCTGTGTCCCCAG 0: 1
1: 0
2: 4
3: 61
4: 509
Right 1076764881 10:132627583-132627605 GATGACAAGTGAAATGAACGAGG No data
1076764872_1076764879 -3 Left 1076764872 10:132627541-132627563 CCCGACTCCCTCTGTGTCCCCAG 0: 1
1: 0
2: 4
3: 61
4: 509
Right 1076764879 10:132627561-132627583 CAGCTGCCAGCAACGTGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076764872 Original CRISPR CTGGGGACACAGAGGGAGTC GGG (reversed) Intronic
900210743 1:1454692-1454714 CAGGGGACACCGAGGCAGACAGG - Intronic
900223701 1:1523090-1523112 CAGGGGACACCGAGGCAGACAGG - Intronic
900290592 1:1922008-1922030 CTGGGGGCTCTGAGGGGGTCTGG + Exonic
900356494 1:2267555-2267577 CTGAGGGCACTGAGGGAGTGGGG + Intronic
900410715 1:2511286-2511308 CTGGGGACACAGCGGGGCCCGGG - Intronic
900438374 1:2641901-2641923 CAGAGGACACAGAGAGAGGCAGG + Intronic
900559680 1:3297748-3297770 CAGGGGACAGGGAGGGAGTCAGG + Intronic
900648200 1:3718401-3718423 CCGGAGACCCAGAGGGAGTGGGG + Intronic
900689391 1:3971109-3971131 CTGGGGCCCCAGGGGGTGTCAGG + Intergenic
900792905 1:4691474-4691496 CTGGGTACACAGTGGGGCTCGGG + Intronic
901084274 1:6601339-6601361 CGGGTGACAAAGAGTGAGTCAGG + Intronic
901091566 1:6645127-6645149 CTGGGGAGACAGAGGGTGCAAGG + Intronic
901305044 1:8226767-8226789 CTGGGGACACAGGGGGGCCCAGG + Intergenic
901798962 1:11696215-11696237 AAGGGGAGACAGAGGGAGTAAGG - Intronic
902603580 1:17556198-17556220 CTGGGAGCACAGGGGGAGGCTGG + Intronic
902650059 1:17831229-17831251 CTGGGGAATGAGAGGGAGTAGGG + Intergenic
902712212 1:18248229-18248251 CTGTGTACACAGTGGGAGCCTGG + Intronic
902724491 1:18325746-18325768 CTGGGAAAACAGATGGAGACAGG - Intronic
903221067 1:21869984-21870006 CAGGGCACACAAAGAGAGTCAGG - Intronic
903451293 1:23455470-23455492 CAGAGGACAAAGAGGGAGTGAGG + Intronic
903462596 1:23530129-23530151 CTGGGGACACTGTGGGACTTTGG - Intronic
903737382 1:25538669-25538691 CTAGGGAGTCAGAGGGAGCCTGG - Intergenic
904055586 1:27668144-27668166 CTGGGGAAACTGAGGCACTCAGG - Intronic
904311040 1:29629823-29629845 CTGGGGATCCAGTGGGTGTCAGG - Intergenic
904452046 1:30619615-30619637 CTGGGAACACAGTGAGAGTTAGG - Intergenic
904551221 1:31320472-31320494 CTGGGGGCATAGAGAGAATCTGG - Intronic
904621215 1:31776486-31776508 CTGGGGAGTCAGAGGCAGTGGGG - Intergenic
904810004 1:33157276-33157298 CCTGGGAAACAGAGGGAGACTGG + Intronic
905174174 1:36125670-36125692 CCGGGGTCACAGAGGCAGGCGGG + Intergenic
905304118 1:37005851-37005873 CTGGGGACACAGAGGTAGATGGG + Intronic
905389938 1:37629807-37629829 CTGGGGACAGAGAGGGTGTGGGG + Exonic
905490255 1:38337869-38337891 CTAGTGACACAGAGTGACTCAGG - Intergenic
906662137 1:47590573-47590595 CTGAGGATAGAGAGGGAGGCTGG + Intergenic
907224016 1:52927911-52927933 CTGGAGGGACAGAGGGAGGCCGG - Intronic
908356417 1:63328210-63328232 CCGGGGACACAGGTGGAGTCCGG - Intergenic
908403375 1:63791231-63791253 ATGGTGACACAGTGAGAGTCTGG + Intronic
908977842 1:69920005-69920027 CTGGGGACTGACAGGGAGTGGGG - Intronic
910846842 1:91612119-91612141 CTTGGGCTCCAGAGGGAGTCTGG - Intergenic
912567329 1:110597469-110597491 ATGGGGAGACAGAGGGAGAGGGG + Intronic
913079857 1:115373411-115373433 CTGGTGATACAGAGTGAATCAGG - Intergenic
914456413 1:147841146-147841168 CAGGGAACCCAGAGGGAGGCGGG - Intergenic
914767333 1:150650261-150650283 CTGGCAACACACAGGGAGTTAGG + Intronic
915477466 1:156161323-156161345 CTGGGGGCACAGGGGGAGTCAGG - Intronic
915652901 1:157332211-157332233 CAGGGGAGGCAGAGGGAGACAGG - Intergenic
915940265 1:160114396-160114418 CTGGGCACAGAGATGGAGTGAGG - Intergenic
916464689 1:165062290-165062312 CTGGGGCCACAGAGAGGGTCTGG + Intergenic
916847234 1:168664588-168664610 CTGGGGAGGAAGAGGGAGTGGGG + Intergenic
917325135 1:173824397-173824419 GTGGGGCCGCAGAGCGAGTCGGG - Intronic
918706393 1:187668294-187668316 CTAGGGACACAAATGGAATCAGG + Intergenic
919131239 1:193453173-193453195 CTAGAGACTCAGAGGGAGTCAGG + Intergenic
919369850 1:196709418-196709440 CGGGGCACAGAGAGAGAGTCAGG - Intronic
919798606 1:201337067-201337089 ATGGGGAGACAGAGGCAGCCCGG + Intergenic
919920056 1:202162133-202162155 CTGGGGACACAGGAGGGGGCAGG + Intergenic
920135262 1:203764198-203764220 CTGGGGACTCTGTGAGAGTCTGG + Intergenic
920430443 1:205915268-205915290 CTGGGGTCACAGGGGGTGTCGGG - Intronic
920500033 1:206480131-206480153 CTGGGCACAGAGGGGGAGGCGGG + Intronic
920501532 1:206488376-206488398 CTTGGGACACTGAGACAGTCAGG + Intronic
922154514 1:223030529-223030551 GTGGGGCCACAGAAGCAGTCTGG + Intergenic
922362791 1:224838601-224838623 GTGGGGGCACAGGGGGAGTCAGG - Intergenic
922874338 1:228928149-228928171 CTGGGGGAAGAGAGGGAGCCCGG + Intergenic
922919095 1:229285586-229285608 TTGAGGCCACAGAAGGAGTCAGG + Intronic
922926083 1:229347677-229347699 ATGGGGACAGAGTGGGAGGCTGG - Intergenic
924104890 1:240640051-240640073 GTCGGGACACAGAGGGAGCGAGG + Intergenic
924199930 1:241648063-241648085 CAGGGGACAAAGAGGTAGGCAGG - Intronic
924445622 1:244127784-244127806 CTGGGGATACAGAGGAAGGTGGG - Intergenic
1063981637 10:11457402-11457424 CTGGGGGCAGTGAGGGAGACAGG - Intronic
1066355906 10:34683644-34683666 CTGGGGCCACCCAGTGAGTCAGG - Intronic
1066642575 10:37571077-37571099 CTGGGGACCCAGAGGGAGACAGG - Intergenic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1067514705 10:46928566-46928588 CTGGGGGCTCAGAGGGAAGCAGG - Intronic
1067647551 10:48123247-48123269 CTGGGGGCTCAGAGGGAAGCAGG + Intergenic
1069656502 10:70093348-70093370 CTCGGGGCACAGAGGCAGTGTGG - Intronic
1069797426 10:71062257-71062279 CTGGGGACACTGAGGATTTCAGG + Intergenic
1069879547 10:71583268-71583290 CTGAGGCCGCAGAGGGAGGCAGG + Intronic
1069887976 10:71635896-71635918 GTGGGGACACAGTGGGAAGCAGG - Intronic
1069987496 10:72294364-72294386 CTGGGGACAGAGGGAGAGTGTGG - Intergenic
1070322732 10:75366531-75366553 GTGGGGACACAGAGGCAGAGCGG - Intergenic
1070630488 10:78081325-78081347 CTGGGGCTACAGAAGAAGTCTGG + Intergenic
1070648764 10:78220084-78220106 CTGTGGACACAATGGGAGTCTGG + Intergenic
1072411247 10:95203986-95204008 CTGGGGAAACACTGGGAGCCTGG - Intronic
1072421291 10:95291977-95291999 TTGGGGTCAGAGAGGGAGTTGGG - Intergenic
1073423615 10:103443052-103443074 CTGAGGACACAGATAGAGGCTGG + Intronic
1074545515 10:114399314-114399336 GAGGGTACACAGTGGGAGTCAGG + Intronic
1075103035 10:119519317-119519339 CTGGGGACAGACAGGGAGACAGG - Intronic
1075143461 10:119862367-119862389 CTAAGGACACACATGGAGTCTGG - Intronic
1075207233 10:120457792-120457814 CCAGGGACACGGAAGGAGTCTGG - Intronic
1075554504 10:123420662-123420684 CTGGGGAAACATCGGGGGTCGGG + Intergenic
1076507905 10:130990127-130990149 CCAGGGACACAGAGGAGGTCCGG - Intergenic
1076516578 10:131048544-131048566 TTAGGGACACAGAGAGAGCCAGG + Intergenic
1076704511 10:132293856-132293878 CCGGGGACGCAGAAGGAGCCAGG + Intronic
1076764872 10:132627541-132627563 CTGGGGACACAGAGGGAGTCGGG - Intronic
1076892658 10:133292356-133292378 CGGGGGACACGGAGGGACACGGG - Intronic
1077155486 11:1089148-1089170 CTGGGGAGGCAGAGGGAGGCCGG - Intergenic
1077538028 11:3133817-3133839 CTGGGGCCAAAGAGGAAGTGTGG + Intronic
1077929599 11:6717239-6717261 CTGTGGACACAGAAGGACTTCGG - Intergenic
1078263744 11:9737169-9737191 CTGGGGACAAAGAGAAATTCTGG + Intronic
1078714740 11:13829104-13829126 GTGGGGAGACAGAGGGAGAAGGG - Intergenic
1078832128 11:14987836-14987858 CTGGTGACACAGCTGAAGTCAGG + Intronic
1079106832 11:17577293-17577315 GTGGGGTCACAGAGGTAGGCAGG + Intronic
1079122445 11:17695701-17695723 CTGAGGACAGAGATGGAGGCCGG + Intergenic
1079125267 11:17714337-17714359 CTGGGGACAGAGAGGGGACCTGG + Intergenic
1080097339 11:28424817-28424839 AAAGGGACACAGAGGAAGTCTGG - Intergenic
1081646080 11:44791622-44791644 CTGGGGACACAGGGGGGACCAGG - Intronic
1081811817 11:45918413-45918435 CTGGGGAAACTGAGGCAGTAAGG + Intronic
1083270421 11:61569500-61569522 CTGGGGCAGCAGAGGGAGCCAGG + Intronic
1083764533 11:64835623-64835645 TTGGGGACATGGAGGGGGTCAGG + Intronic
1083767238 11:64847430-64847452 CTGAGGTCACACAGGGAGTGAGG - Intergenic
1084013517 11:66365712-66365734 CTGGGGACACAGAGGTCAGCTGG + Intronic
1084323004 11:68384059-68384081 CTGGGGAAACTGAGGCAGGCAGG - Intronic
1084346090 11:68549923-68549945 CTGTGGAGACAGCAGGAGTCTGG + Intronic
1084421398 11:69062447-69062469 ATGGGGACACAAGGGGAGGCGGG + Intronic
1084560834 11:69904760-69904782 CTGGGGACACTGTGGGAATTGGG - Intergenic
1085024880 11:73230569-73230591 CTGAGGAAACAGAAGCAGTCTGG + Intronic
1085040810 11:73325241-73325263 CTAGGGGCCCAGAGGGAGACAGG - Intronic
1085711303 11:78831319-78831341 CTGGGGCCATAGAGGGAGTTAGG - Intronic
1085751702 11:79167816-79167838 CTGTGGACACAGAAGGAGCCTGG - Intronic
1087133690 11:94693247-94693269 CTGGGCCCAAAGAAGGAGTCTGG - Intergenic
1087609962 11:100422470-100422492 GTGGGGTCACAGTGGGAGTGAGG + Intergenic
1087723559 11:101693935-101693957 CTGGGGAACCAGGGGGAGCCTGG + Intronic
1088170095 11:106986761-106986783 CTTGGGACATGGAGGAAGTCAGG - Intronic
1088365685 11:109037657-109037679 CTGGGGACAGAAAGAGGGTCAGG - Intergenic
1088913989 11:114213054-114213076 CTGTGGGCACACAGGGGGTCGGG - Intronic
1089004985 11:115083836-115083858 CTGGGGACAGTGAGGCAGTGTGG - Intergenic
1089342500 11:117767999-117768021 GTGAGGACACAGAGGCAGTGTGG - Intronic
1089668544 11:120035726-120035748 CCAGGGACACAGAAGGAGCCAGG - Intergenic
1089842012 11:121426696-121426718 TTGGCAACACAGAGGCAGTCTGG + Intergenic
1090412002 11:126515705-126515727 CTGGGGACACAGCTGGGGGCTGG + Intronic
1090579995 11:128148986-128149008 GTGGGGACAGTGAGGGAGGCTGG + Intergenic
1091076999 11:132628659-132628681 CTGGGGACACAGGTGGTGTAAGG - Intronic
1091250740 11:134141756-134141778 CAAGGGGCACAGAGGGAGGCAGG + Intronic
1091354423 11:134924702-134924724 CTGGGGAAAATGAGGGGGTCAGG - Intergenic
1092033003 12:5305526-5305548 CTGGGGACAAAGGGAGAGGCAGG - Intergenic
1092968331 12:13667342-13667364 CAGGGGACACATATGCAGTCTGG - Intronic
1093718487 12:22411176-22411198 CTGAGGTCAGAGAAGGAGTCAGG + Intronic
1093861716 12:24174428-24174450 TTGGGGAGATAGAAGGAGTCTGG + Intergenic
1095535435 12:43240519-43240541 TTGAGAACACAGAGGGAGTGGGG - Intergenic
1096478815 12:51924557-51924579 CTGGGGTCCCTGAGGAAGTCAGG - Intergenic
1096869066 12:54582132-54582154 CTGGGGACACAGAGAAAGGGAGG + Intronic
1097140829 12:56901278-56901300 CTGGGGAAACTGAGGGTATCTGG + Intergenic
1098301854 12:69062369-69062391 CCAGGATCACAGAGGGAGTCAGG + Intergenic
1098971887 12:76865937-76865959 ATGGGGACACAAAGGGAGGCTGG + Intronic
1100721986 12:97368959-97368981 ATGGGTGCACAGTGGGAGTCCGG - Intergenic
1101857595 12:108456832-108456854 CCAGGGACACAGCGGGAGGCCGG - Intergenic
1102460608 12:113097399-113097421 CGGGGGGCAAAGAGGGACTCGGG + Exonic
1102605305 12:114063875-114063897 CCGGTAACCCAGAGGGAGTCAGG - Intergenic
1102605354 12:114064019-114064041 CCGGTAACCCAGAGGGAGTCAGG - Intergenic
1102605452 12:114064380-114064402 CCGGTAACCCAGAGGGAGTCAGG - Intergenic
1102605462 12:114064416-114064438 CTGGTAACCCAGAGGGAGTCAGG - Intergenic
1102605480 12:114064488-114064510 CCGGTAACCCAGAGGGAGTCAGG - Intergenic
1102605498 12:114064560-114064582 CTGGTAAACCAGAGGGAGTCAGG - Intergenic
1102955990 12:117059315-117059337 CCGGGGACACAGAGGGACCCGGG - Intronic
1103401238 12:120644420-120644442 CTGGCCACAAAGAGGGAGTACGG - Intronic
1103572898 12:121856807-121856829 CTGAGGATCCAGAGGGGGTCTGG - Intronic
1103841385 12:123868075-123868097 CTGTTGACACAGAAGGAGTTTGG + Exonic
1103905686 12:124326266-124326288 CTGAGGAGACAGAGGGTGGCCGG + Exonic
1104677063 12:130718379-130718401 CAGGCCACACAGATGGAGTCAGG - Intergenic
1104710567 12:130982839-130982861 CTGGGGACACAGAAGGACTCAGG + Intronic
1104750352 12:131234516-131234538 CTGGGGACACAGAGGAATTAAGG - Intergenic
1104782369 12:131429946-131429968 CTGGGGACACAGAGGAATTAAGG + Intergenic
1104856132 12:131903296-131903318 CCGGGGACACAGAGGGTGACTGG + Intronic
1105865054 13:24451691-24451713 CAGGGGCCACAGAGGCAGGCAGG + Intronic
1105964912 13:25374777-25374799 CTGGGGACACTGATGGAAACAGG + Intronic
1106777136 13:33019486-33019508 GTGGAAACACAGAGGGAGTGAGG - Intronic
1107064306 13:36195996-36196018 GTGGTGACACAGAGGGAATAGGG + Intronic
1108132459 13:47317486-47317508 CTGAGGGCACAGAGGTTGTCTGG + Intergenic
1108561017 13:51644102-51644124 GGGGAGAGACAGAGGGAGTCAGG + Intronic
1111908942 13:94288417-94288439 CTGGGGACATGGAGGGAGGTGGG - Intronic
1112103723 13:96218166-96218188 CTGGGGACACAGAGATGGTGAGG - Intronic
1113972450 13:114200302-114200324 CTGGGGACAGAGAAGGAGGCTGG - Intergenic
1115963926 14:38865490-38865512 CTGGGCATGCAGAGGGAGTGAGG + Intergenic
1116787289 14:49301609-49301631 CTGAAAACACAGAGGGACTCAGG + Intergenic
1117029280 14:51652059-51652081 CAGGGGGCACAGCGGGCGTCCGG - Intronic
1117276889 14:54202887-54202909 CCGGGGTTACAGACGGAGTCTGG + Intergenic
1118971889 14:70643751-70643773 CTGGGAAGACAGAGGTAGGCTGG - Intronic
1119644684 14:76339768-76339790 CTGGGGCCATAGAGGCAGCCAGG - Intronic
1120207088 14:81598637-81598659 CTGGGGATACTGAGGAAGCCAGG - Intergenic
1121003090 14:90465976-90465998 CAGGGGAGAGAGAGGGAGACTGG + Intergenic
1121089244 14:91169949-91169971 CAGGGGCCACAGTGAGAGTCTGG + Intronic
1121260149 14:92559924-92559946 CTGGGAGCACAGAGTGAGCCTGG + Intronic
1121444809 14:93972176-93972198 CTGGGGACACACGAGGAGTCAGG + Intronic
1121544057 14:94750747-94750769 GTGGCCACACAGAGGGTGTCAGG - Intergenic
1122122288 14:99561009-99561031 CTGTGGAGACTGAGGGAGGCAGG - Intronic
1122348281 14:101073636-101073658 CTGGGGCTGCAGAGGGAGGCCGG - Intergenic
1122443393 14:101750188-101750210 CTGGGGAAACACAAGGGGTCAGG - Intergenic
1123024476 14:105418313-105418335 CTGAGGAGACAGAGGTAGGCTGG + Intronic
1125518862 15:40337447-40337469 CTGTGTAGACAGAGGGAGTCAGG + Intronic
1126589312 15:50323465-50323487 CTGAGGACCCAGAGTGAGGCAGG + Intronic
1127198757 15:56620083-56620105 CTGAGGGCACAGAGAGACTCAGG - Intergenic
1127467311 15:59256851-59256873 CTGGGGCCTCAGAGGGAATTAGG + Intronic
1128322915 15:66705160-66705182 CTGGGAGCACAGAGAGGGTCAGG + Intronic
1128349543 15:66879891-66879913 CTGGGGAGCCAGAGGGAGATGGG - Intergenic
1128683598 15:69668193-69668215 GTGGGGACACGGGGTGAGTCAGG - Intergenic
1129287919 15:74540972-74540994 GTGCGGACACAGAGGGGTTCCGG - Intergenic
1129361927 15:75029708-75029730 CTGGGTACACAGCGGGTGGCTGG - Intronic
1129389468 15:75213457-75213479 CTGGGGCCACAGAGGAACCCAGG - Intergenic
1129462415 15:75706225-75706247 CTGGGGAGACAGAGGGGGCTGGG - Intronic
1130225615 15:82056293-82056315 CTGGCCACACAGAGAGAGGCGGG + Intergenic
1132322237 15:100934427-100934449 CTGGGGACACAGCAGGAGTGTGG + Intronic
1132554199 16:565451-565473 CTGGGGCCACACAGGGACACTGG + Exonic
1132594809 16:743880-743902 CTGGGGACATAGGGCGAGGCCGG + Intronic
1132730956 16:1361849-1361871 CTGGGGACACAGATGGCATGAGG - Intronic
1132826148 16:1906659-1906681 CTGAGGACACGAAAGGAGTCTGG + Intergenic
1132925127 16:2425310-2425332 CTGGGGACACACAGCAAGCCAGG + Intergenic
1132942798 16:2516530-2516552 CTGGGGACACAGCTGGAGGTTGG - Intronic
1132973838 16:2701847-2701869 CTGGTGACCCGGAGGGAGGCAGG + Intronic
1133059473 16:3165109-3165131 ATGGGGACACAGATTGAGTTGGG - Intergenic
1133771009 16:8867274-8867296 CAGGGGTCACAGAGGGAGTGGGG - Intronic
1134101048 16:11451782-11451804 CTGGGGAAACTGAGGCAGACAGG + Intronic
1134247634 16:12551841-12551863 CTGGGGACACAGGAGCAGGCAGG + Intronic
1135181842 16:20281592-20281614 CTGAGGGCAGAGAGGGAGGCAGG + Intergenic
1135325674 16:21523916-21523938 CTGGAGCCCCCGAGGGAGTCTGG + Intergenic
1136609447 16:31357230-31357252 CTGGGGACACAGCGGGCTGCTGG - Intronic
1136772940 16:32857477-32857499 CTGGGGACACCACGGGAGACAGG + Intergenic
1136861980 16:33710061-33710083 CTGGGGACACCACGGGAGACAGG + Intergenic
1136897674 16:34004042-34004064 CTGGGGACACCACGGGAGACAGG - Intergenic
1137487605 16:48904745-48904767 ATGGGGACAGAGAGGGAATGAGG - Intergenic
1138495889 16:57409181-57409203 CTGGGGACATAGAGGAAGGAAGG + Intronic
1139252008 16:65505581-65505603 CTGGGGATAAAGAGGGTGTGAGG + Intergenic
1139272890 16:65700034-65700056 CTGGTGAGACATAGGGTGTCAGG - Intergenic
1140558892 16:75954424-75954446 CGGTGCACACAGAGGGAGCCTGG + Intergenic
1141664566 16:85459224-85459246 GTGGAGACACAGAGGGTGCCTGG - Intergenic
1141703117 16:85651416-85651438 CTGAGGACAAACAGGGAGTCCGG - Intronic
1141805906 16:86341343-86341365 CTGTGGACACACAGGGAGCGCGG + Intergenic
1141980951 16:87550390-87550412 CAGGGGCCGAAGAGGGAGTCAGG - Intergenic
1142145475 16:88491210-88491232 CAGGGGACACTGAGGCAGTCAGG - Intronic
1142253168 16:89002118-89002140 CTGGGGAGACAGAGGAACTGGGG + Intergenic
1142342454 16:89532438-89532460 GAGGGGACACAGAGAGAATCAGG - Intronic
1203075365 16_KI270728v1_random:1119587-1119609 CTGGGGACACCACGGGAGACAGG + Intergenic
1142612161 17:1115020-1115042 CTGAGGCCACAGAGGTAGGCAGG + Intronic
1143141110 17:4742308-4742330 CTGGGGACACAGCGGGTGGTGGG - Intronic
1143365699 17:6406977-6406999 CTCAGGTCAGAGAGGGAGTCAGG + Intronic
1143465123 17:7131384-7131406 ATGGGGCCAGAGAGGGAGGCAGG + Intergenic
1143562160 17:7702671-7702693 CTGGAGACCCCGAGGGAGGCAGG + Intronic
1143739995 17:8945459-8945481 CTGGTGACCCAGAGAGAGCCTGG + Intronic
1143786360 17:9258758-9258780 CTGGAGCCACAGAGGAAGCCTGG - Intronic
1144136273 17:12297994-12298016 CTGAGGACAGAGAGGAAATCTGG - Intergenic
1144274857 17:13656463-13656485 GTGGGGACACAGAGGGAAGGGGG + Intergenic
1144580554 17:16456633-16456655 GAGGGAACACAGAGGGAGGCAGG + Intronic
1145835157 17:27949323-27949345 CTGGGGACTCATAGGCTGTCTGG + Intergenic
1145902933 17:28499729-28499751 CTGGGGACACAGCTCGAATCAGG - Intronic
1146932153 17:36785094-36785116 CTGGGATCATGGAGGGAGTCAGG - Intergenic
1147340525 17:39750975-39750997 CAGGGGTCGCAGAGGGAGTTCGG + Intergenic
1147745506 17:42692040-42692062 CTGGGGAGACAGGGGTAGGCTGG + Intronic
1148051463 17:44771992-44772014 CTGGGGGCACAGGGGGAGCTGGG - Intronic
1148334352 17:46831757-46831779 CCGGGGACACACAGCCAGTCAGG - Intronic
1149386860 17:56150995-56151017 CTGGGGACAGAGTGAGAGGCAGG + Intronic
1149571958 17:57678404-57678426 TTGGGGACCCAGAGGAAGTAAGG + Intronic
1151391866 17:73792882-73792904 CTGGGGACAAAGAGGAAATGAGG - Intergenic
1151426321 17:74033107-74033129 ATGGGGAGAGAGAGGAAGTCAGG + Intergenic
1151700785 17:75741436-75741458 ATGGGGAGAGAGAGGGAGTGAGG + Intronic
1151871650 17:76840832-76840854 CTGAGGGAACAGAGGGAGTCAGG - Intergenic
1151929015 17:77219128-77219150 CTGGGGACACGGAGGCTGTTGGG + Intergenic
1152193715 17:78903782-78903804 CATGGGACACTGGGGGAGTCTGG + Intronic
1152573408 17:81130212-81130234 CTGGGAACACAGAGGCAGGAGGG - Intronic
1152717722 17:81907859-81907881 TGGGGGACACAGTGGGAGTGGGG + Intronic
1153915638 18:9741908-9741930 CCAGGGACCCAGAGGGAGCCAGG + Intronic
1153941993 18:9986563-9986585 CTGGGGACAGTGAGGGTCTCAGG + Intergenic
1155225261 18:23724421-23724443 CTGGGGAGACAGAGGACATCAGG - Intronic
1157102381 18:44742700-44742722 CTAAGGACACAGAGGCAGGCTGG - Intronic
1157382545 18:47232560-47232582 CTGGGGACACAGAGGAGGGATGG - Intronic
1157424321 18:47571884-47571906 CAGGGGACTCAGGGGGACTCAGG - Intergenic
1157626381 18:49054689-49054711 CTGGCGACACAGAGGGACTTGGG + Intronic
1157719545 18:49913485-49913507 CTGAGGACACAGAGAAAGTGGGG - Intronic
1157779752 18:50427768-50427790 CTGGGGACATAGTGGGAGGCAGG + Intergenic
1160357525 18:78240710-78240732 CTTGGGACACAGTCGAAGTCTGG + Intergenic
1160534684 18:79585718-79585740 GTGGGGACACAGTGGGAGCATGG - Intergenic
1160723627 19:608237-608259 CTGGGGTCTGAGAGAGAGTCAGG + Intronic
1160905101 19:1448193-1448215 CTTGGGACACAGGGGGTGTCTGG - Intronic
1160956257 19:1693405-1693427 CTGGGGAGTCAGAGAGAGACTGG - Intergenic
1161266093 19:3365513-3365535 CTGGGGGCTCAGACGGAGGCAGG + Intronic
1162024862 19:7888252-7888274 CTGGGGAAACTGAGGGAGCTGGG - Intergenic
1162446792 19:10728307-10728329 CTGAGGCCAGAGAGGGAGACTGG + Intronic
1162931234 19:13958979-13959001 CTGGGGACACTGAGCGAGGCTGG + Intronic
1163469376 19:17487633-17487655 CTGGGGACAGAGAGGGCAGCTGG + Intronic
1163759867 19:19130364-19130386 CTGGGGTCCCAGACGGAGTGTGG - Intronic
1164554708 19:29242713-29242735 CTGGGGACACTGTAGCAGTCAGG - Intergenic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164727515 19:30476184-30476206 CTGGGGCCACAGAGGGAAGAAGG - Intronic
1165168742 19:33875810-33875832 CTGGGCATAGAGAGGGAGTTTGG - Intergenic
1165333683 19:35154975-35154997 CTGGGGAGACTGAGGCAGGCGGG - Exonic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165797407 19:38526970-38526992 CTGGGGAGACAGAGCCAGGCTGG - Intronic
1165843262 19:38802158-38802180 CTGGGGACAGAGAGGGATGGGGG + Intronic
1165846060 19:38818398-38818420 CTGGGGACACAGGTGGAAACAGG - Intronic
1166053350 19:40274241-40274263 CTGGGGACACAGTGGGGGCTAGG - Intronic
1166147076 19:40845234-40845256 CTGGGGACACAGAGAGGGGCTGG + Intronic
1166151232 19:40877131-40877153 CTGGGGACACAGAGAAGGGCTGG + Intronic
1166179072 19:41094477-41094499 CTGGGGACACAGAGAGAGGCTGG - Intronic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1166666397 19:44682902-44682924 CTGGGGCCACACAGCCAGTCAGG + Intronic
1166764566 19:45245198-45245220 CTGGGGGCAAAGAGAGAATCTGG - Intronic
1166945901 19:46396096-46396118 CTGGGCCCACAGAGGAGGTCTGG - Intergenic
1167120614 19:47514460-47514482 CTGGGGGGACGGAGGGAGTCCGG - Intronic
1167473752 19:49688883-49688905 CTGGGGACACTGAGTGGGTTGGG + Exonic
1167688239 19:50969516-50969538 CTGGGGACACAGAGGTCGGCAGG - Intronic
1168056019 19:53865911-53865933 CTGTGGACAGATAGGGAGTCGGG - Intergenic
1168293486 19:55368441-55368463 CTGGGGACAAGGTGGGAGGCAGG - Intronic
1168595072 19:57668865-57668887 CTGGTGAAACAGAGGGGGCCCGG - Intergenic
925336489 2:3102511-3102533 CTGGGCGCACAGCGGAAGTCAGG + Intergenic
925341696 2:3142459-3142481 CTCAGGTCTCAGAGGGAGTCAGG + Intergenic
926147010 2:10402565-10402587 CTGGGGCCACCGAGGGCGGCTGG + Intronic
926995626 2:18732422-18732444 CTGGAGACACAGAAGGATTGGGG + Intergenic
928498660 2:31863307-31863329 CTGGGGCAACAGAGCGAGACTGG + Intergenic
929900030 2:45992849-45992871 CTGGGGACACACTGGGGTTCAGG - Intronic
930020797 2:47000977-47000999 CTGGAGGCACAGAAGGAGCCAGG + Intronic
930115253 2:47712587-47712609 ATGGATACACAGAGGGAATCAGG + Intronic
930265980 2:49199542-49199564 CAGGGGACACAGAGGGACAATGG - Intergenic
930595266 2:53379850-53379872 CTGTGGACAGTGAGGGGGTCAGG - Intergenic
931257265 2:60584543-60584565 CTGGAGTTACAGAGGGAGTTGGG - Intergenic
931419884 2:62117083-62117105 GTGGGGGCAAAGAGGGAGGCAGG - Intronic
932355431 2:71064607-71064629 CTGGAGTCACGGAGGGAGCCAGG - Intronic
932435165 2:71699080-71699102 CTGGGCACACAGCGGGGCTCAGG + Intergenic
934762801 2:96865633-96865655 CTGGGGACACCGAGGTAGGAGGG + Intronic
935744545 2:106179101-106179123 ATGGAGCCACAGAGGGAGACTGG - Intronic
935976604 2:108584844-108584866 TTGGGGACATAGATGGAGCCAGG + Intronic
935981748 2:108634968-108634990 CTGGGGTCACAGAGGAACCCAGG + Intronic
936461142 2:112714494-112714516 CTGGGGTCAGAGAATGAGTCAGG - Intergenic
937243897 2:120479973-120479995 CTGGGACCACAGAGGGACTTGGG - Intergenic
937317383 2:120940607-120940629 CTGGGGTCACAGAGAGAGAATGG - Intronic
937376667 2:121341128-121341150 CTAGGGCCACAGAGGGAGGGAGG + Intronic
938207757 2:129438537-129438559 CTGGGGAGGGAGAGGGAGCCTGG - Intergenic
938321631 2:130370165-130370187 CAGTGGACACAGAGGGGTTCAGG - Exonic
938398193 2:130965798-130965820 CCAGGGACACAGAGGCAGCCTGG + Intronic
941951605 2:171161236-171161258 CGCGGGAGACAGGGGGAGTCAGG - Intronic
944464954 2:199991714-199991736 CTGGGGACAAAGAGGCAGCCAGG - Intronic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946307892 2:218866245-218866267 GTGGGGAAATAGAGGGAGGCTGG + Intronic
947004585 2:225496230-225496252 CTGAGGTTACAGAGGGAGTGAGG + Intronic
947635789 2:231680305-231680327 CTGGGGACACCTGGGGAGGCGGG + Intergenic
947908575 2:233785568-233785590 GTGAGGAGGCAGAGGGAGTCAGG + Intronic
948763879 2:240209653-240209675 CCGGGCACACAGTGGGAGTCTGG - Intergenic
948890648 2:240905533-240905555 CTGGGGCCTCAGATGAAGTCAGG - Intergenic
948922686 2:241073127-241073149 CTGGGGCCACGCAGGGAGCCTGG + Intronic
949029511 2:241785610-241785632 ATGGGAACCCAAAGGGAGTCTGG + Intronic
1168952808 20:1814126-1814148 CTGGGGGCACAGAGGCGGGCTGG - Intergenic
1169287102 20:4318505-4318527 CTGGGGACAGGAAGGGAGTGGGG + Intergenic
1170932448 20:20781335-20781357 GTGGGGACACAGAGATATTCAGG + Intergenic
1171247697 20:23625912-23625934 CTGGGGGCACAGAATGAGGCTGG - Intergenic
1172112609 20:32556173-32556195 ATAGAGACACAGAGGGAGGCAGG - Intronic
1172154066 20:32811193-32811215 TGGGGGACTCAGAGGGAGTATGG + Intergenic
1172367807 20:34363381-34363403 CTCGGGAGAGGGAGGGAGTCCGG + Intronic
1172994122 20:39057514-39057536 CCAGGGACACAGAGTGAGTAGGG - Intergenic
1173018030 20:39244481-39244503 CTGGAAGCACAGAAGGAGTCAGG - Intergenic
1173317886 20:41961395-41961417 CTGTGGAGACACAGGGAGGCAGG - Intergenic
1173747702 20:45450328-45450350 CTGGTGGCACCGAAGGAGTCAGG + Intergenic
1173809565 20:45947817-45947839 CTGGGGCCTCAGAGGGACCCCGG + Exonic
1173944639 20:46940933-46940955 GTGGCGAGACAGATGGAGTCAGG - Intronic
1174366035 20:50057139-50057161 CTGGGGCCACACAGCAAGTCAGG - Intergenic
1174452907 20:50630797-50630819 CTGGGGACACAGGGGCCGTGGGG - Exonic
1174503002 20:50999379-50999401 CTGGGGACATGGTGGGAGTGTGG + Intergenic
1175236564 20:57516985-57517007 CTGGGGAGGCAGATGGAGTGTGG - Intronic
1175247177 20:57589203-57589225 CTGAGGCCACACAGGGAGGCAGG + Intergenic
1175522597 20:59611698-59611720 CTGGGGCCGGAGAGGGAGGCAGG - Intronic
1175642920 20:60646403-60646425 CTGTGGACAGAGAGGGTGGCTGG + Intergenic
1175850250 20:62086764-62086786 CTGGGCACACAGAGAGACTGGGG + Intergenic
1175902123 20:62364072-62364094 CTGGGGACACAGCGGGAATAAGG - Intronic
1176056528 20:63151834-63151856 CTGGAGAGCCAGAGGGAGCCGGG + Intergenic
1178476307 21:32940271-32940293 CTGGGCACACAGGCAGAGTCGGG - Intergenic
1179438073 21:41375593-41375615 CTGGAGACACACAGGGAGAAGGG - Intronic
1179546604 21:42116454-42116476 CCAGGGACACTCAGGGAGTCAGG - Intronic
1179721134 21:43316535-43316557 CTGGGGACTCAGCTGGACTCAGG - Intergenic
1180018626 21:45104453-45104475 GTGGAGACACAGTGGGGGTCAGG + Intronic
1180660589 22:17463606-17463628 CTGGGGAGTTAGAGGGAATCAGG + Intronic
1181264760 22:21624462-21624484 CTGGGGACTCAGAGTGTTTCTGG - Intergenic
1181522944 22:23459885-23459907 CTGGGGGCCCAGGGGGCGTCTGG - Intergenic
1181608775 22:23998920-23998942 CTGAGGACTCTGAGGGATTCTGG - Intergenic
1181893304 22:26083975-26083997 CTAGGGACAGAGATGGAGGCAGG + Intergenic
1182003595 22:26940889-26940911 GTGGGGGCACAGAGGGAGGGAGG + Intergenic
1183370066 22:37427234-37427256 CCGGGGAGACGGTGGGAGTCGGG - Intronic
1183792849 22:40087776-40087798 CTGGAGACTGAGAGGGAGGCAGG + Intronic
1184488183 22:44793972-44793994 CTGGGGAGACCGAGGGAGCGAGG + Intronic
1184588220 22:45462139-45462161 GTGGAGACACACAGAGAGTCTGG + Intergenic
1184684664 22:46090705-46090727 ATGGGGCCACGGAGGGGGTCAGG - Intronic
949115444 3:315718-315740 CTGGAGAACCTGAGGGAGTCAGG + Intronic
949610333 3:5697714-5697736 CAGAGGGAACAGAGGGAGTCAGG - Intergenic
949844022 3:8352181-8352203 CTGGGGACAATGAGGTAGTGGGG + Intergenic
949944747 3:9180978-9181000 CTGGAGACACGGAGGCAGCCGGG + Intronic
950193022 3:10991506-10991528 GTGGGGAAACAGAAGAAGTCAGG + Intergenic
952881533 3:37989038-37989060 CCAGAGACACAGAGGGAGGCTGG + Intronic
953235698 3:41104197-41104219 CTGGGGACACAGAAAGGGGCGGG + Intergenic
953888904 3:46736157-46736179 CTGGGGACCCAAACGGTGTCAGG - Intronic
954081742 3:48216303-48216325 CTGAGGTCACAGAGGGTTTCAGG - Intergenic
954303643 3:49714293-49714315 CAGGGGACACGTAGGGAGTCTGG - Intronic
954808735 3:53235175-53235197 CTGTGGACAGAGAGTGAATCAGG + Intronic
954876863 3:53807971-53807993 CTGGGGACACTTAGGGTATCTGG + Intronic
957106751 3:75899459-75899481 CTGAGGTCACAGAGGTAGTCAGG - Intergenic
958970109 3:100601627-100601649 CTGGGGCAGCAGAGGAAGTCAGG - Intergenic
961148747 3:124617983-124618005 CTGGGGGCAGAGAGACAGTCTGG + Intronic
961742371 3:129040774-129040796 CTGGGGAAACTGCAGGAGTCAGG + Intergenic
962342737 3:134598757-134598779 CTGGGGACCCAGGAGGAGTTGGG + Intronic
962439048 3:135395081-135395103 TGGGGGACACAGAGGGAGGGAGG - Intergenic
962447804 3:135483774-135483796 CTGGGGACACACAGGTCATCTGG - Intergenic
962479118 3:135783109-135783131 CTGGGGACTCAGTGGGACTGAGG - Intergenic
962832731 3:139158573-139158595 CTGGGGGCACAGGGGGAGAAGGG + Intronic
963640237 3:147852372-147852394 GTAGGAACACAGAGGGAGTTGGG + Intergenic
964927626 3:161977503-161977525 CTGGGGCAACTGAGGGTGTCTGG - Intergenic
965682479 3:171265746-171265768 CTGGGGAAACAGAGGGAAAGTGG + Intronic
967019523 3:185510302-185510324 CTGTGGACAGAGAGGGAGACAGG - Intronic
968582233 4:1400484-1400506 CTGGGGACCCAGTAGGAGTGTGG + Intergenic
968759323 4:2433878-2433900 CTGGGGACTCCGAGGGAGCTGGG + Intronic
968939262 4:3629637-3629659 CTCTGGACTCAGAGGGAGCCAGG - Intergenic
969323033 4:6424541-6424563 CTGTGGATACACAGGGAGGCCGG + Intronic
969444739 4:7238270-7238292 CTGGGGAGGTAGAGGGAGTCTGG + Intronic
969696326 4:8737193-8737215 CTGGGGACGCAGAGGCTGTAAGG + Intergenic
969988244 4:11234040-11234062 CTGGGGAGACAGAGGTCATCGGG - Intergenic
970974131 4:22023413-22023435 CTGGGGACACAGGTTGAGGCTGG + Intergenic
971424326 4:26501343-26501365 GTGAGGCCACAGAGGGAGGCAGG - Intergenic
971477702 4:27087908-27087930 CTGGGGACATAGGGGTAGGCAGG - Intergenic
972984669 4:44749265-44749287 CTGGTGACACCGAGGGAAACAGG - Intergenic
973928240 4:55761814-55761836 CTGAGGTCACAGAGGTAATCCGG - Intergenic
975661124 4:76689720-76689742 CTGGGCACGGAGAGGGAGGCGGG + Intronic
976444566 4:85116023-85116045 CTGGGGGGACAGAGAGAGGCAGG - Intergenic
977049303 4:92106888-92106910 CTGGGGGCACAGAGGCAGGGTGG + Intergenic
977979943 4:103309568-103309590 CTGGGAATACAAAGGCAGTCGGG + Intergenic
980532301 4:134071178-134071200 CTGAGGAGTCAGTGGGAGTCAGG + Intergenic
980738106 4:136917427-136917449 CTGTGGAGCCAGAGGGAGCCAGG + Intergenic
982344643 4:154344040-154344062 CTGGGGAGAGAGAGAGAGACGGG + Intronic
984778579 4:183504868-183504890 CTGGGGACTCCGAGGGGGACAGG + Intergenic
985519953 5:369533-369555 CAAGTGACACAGAGGGAGCCCGG - Intronic
985621462 5:958346-958368 CAGGGGACACTGCGGCAGTCAGG + Intergenic
985781603 5:1874516-1874538 ATGGGGAGAGAGAGGGAGGCCGG + Intergenic
986323699 5:6655407-6655429 CTGGGGATACCGTGGGATTCTGG + Intronic
990591616 5:57271176-57271198 CTGGTGACACAGCAGGAGCCAGG + Intergenic
990977652 5:61573342-61573364 CTGGGGACACAATGGGCCTCTGG + Intergenic
991721414 5:69497410-69497432 CTGGCGACACAGTGAGACTCTGG - Intronic
994245136 5:97469556-97469578 CTGGGGAAACTGAGGGTATCTGG - Intergenic
995186326 5:109275494-109275516 CTGGGGACAGGGAGAGAGTTCGG + Intergenic
996417699 5:123227971-123227993 CTGGGGACCCAGTGGGAGTGGGG - Intergenic
997700639 5:135896236-135896258 CTGGGGAGACAGAGCGGGTTGGG + Intergenic
998024097 5:138798885-138798907 CTGGGGAAACTGAGGTAGACAGG - Intronic
998162742 5:139822621-139822643 CCTTGGACACAGAGGGAGGCCGG - Intronic
998342493 5:141430817-141430839 CTGGGGACTCTGTGGGAGACCGG + Exonic
998467911 5:142360601-142360623 AGGGGGAGACAGAGGGATTCAGG - Intergenic
998516873 5:142763835-142763857 ATGGGAAAACAGAGGGAGCCAGG - Intergenic
999147466 5:149405776-149405798 CTGGGGACACAGAGCCTGCCAGG + Intergenic
999571851 5:152927556-152927578 CAGGTGACACAGAAGGAGTTAGG + Intergenic
1000197306 5:158972182-158972204 CTGGGGACACAGATTGAGGTGGG - Intronic
1001412880 5:171523355-171523377 CTGGGCACACAAAGGAAGTAGGG - Intergenic
1001847936 5:174938061-174938083 CTGGGGATACAGAGGGGATGAGG - Intergenic
1001924637 5:175627290-175627312 CTGTGGGCACAGAGCAAGTCGGG - Intergenic
1002176789 5:177405186-177405208 CTGGGGACAAAGAGGGATAGTGG + Intronic
1002177355 5:177408775-177408797 CTGGGGAAACTGAGGAAGGCTGG + Intronic
1002439286 5:179256021-179256043 CTGGGGACAGAGAAGGAGACTGG - Intronic
1002640256 5:180627322-180627344 CTGGGGTCGCAGAGTGAGGCAGG + Intronic
1003499922 6:6695544-6695566 CTGGGGCGACAGTGGGAGTGTGG + Intergenic
1004463545 6:15862034-15862056 ACAGGGGCACAGAGGGAGTCAGG + Intergenic
1006374029 6:33662161-33662183 CCGGGGACACTGAGGGGGTAAGG + Intronic
1006375753 6:33670916-33670938 CTGGGGACACAGAAGGAAGTGGG - Intronic
1007458186 6:41997056-41997078 CTGGGGACAGACAGGGATACTGG - Intronic
1008078442 6:47170090-47170112 TTGGGAGCACACAGGGAGTCAGG + Intergenic
1008902701 6:56640340-56640362 CTGGAGTGACAGATGGAGTCAGG + Exonic
1012019414 6:93898314-93898336 CTGGAGACACAGAGAGACACAGG - Intergenic
1012096571 6:94970087-94970109 GTGGGGACATAGATGGAGCCGGG + Intergenic
1015680979 6:135808138-135808160 CTGGAGAGACAGAGGGTGACTGG - Intergenic
1015930502 6:138354714-138354736 CTGGGAACACGGTGGGAGCCTGG - Intergenic
1015935235 6:138402300-138402322 CTGGGGACAGGGAAGGAGGCAGG + Intergenic
1016996049 6:149963092-149963114 CTGGGGGCAAAGTGGGACTCAGG + Intergenic
1017797996 6:157865000-157865022 CTGGCGACAGAGAGAGACTCTGG + Intronic
1017815927 6:158016757-158016779 CTGGGCACTCAGAGGTACTCAGG + Intronic
1019024916 6:168951353-168951375 CTTGGGACACTGAGCGGGTCTGG - Intergenic
1019074137 6:169373450-169373472 CTGGGGACCCAGGGGGAGCGTGG + Intergenic
1019127424 6:169850100-169850122 GTGGGGACACAGCTGGAGGCAGG - Intergenic
1019205187 6:170355553-170355575 CTGGGGACTGTGAGGGGGTCGGG + Intronic
1019325925 7:438264-438286 GCGGGGACACAGAGGGAGCTTGG - Intergenic
1019372846 7:672059-672081 CTGGGAACACAGTGGGGGTAGGG - Intronic
1019442790 7:1055888-1055910 CTGGGGACTCAAGTGGAGTCTGG + Intronic
1019520561 7:1458895-1458917 CCAGGGACACAGAGGGGGACTGG + Intronic
1019558349 7:1643576-1643598 CTGGGGACTCAGAGGGAATGGGG + Intergenic
1019588384 7:1816666-1816688 CTGGGGGCCCAGGGGGAGTCTGG + Intronic
1019595578 7:1856882-1856904 CTGGGGACACACAGGCAGCGAGG - Intronic
1020944549 7:14585944-14585966 CTGAGGACACAAAGAGAGACAGG - Intronic
1021412479 7:20344063-20344085 ATGGGGACAGAGAGGAAGTAAGG + Intronic
1023292041 7:38678656-38678678 GGGGGCACACAGAGGGAATCAGG + Intergenic
1023992753 7:45139212-45139234 CTGGGGAGACAGAGAGAGGGCGG - Intergenic
1024159915 7:46663516-46663538 CTGGGAAAGCAGAGGGAGTAAGG + Intergenic
1024554616 7:50592834-50592856 CTGGGGACCCAGAGCGAGATGGG - Exonic
1024793942 7:53000980-53001002 CTGGAGATAAAGAGGGTGTCTGG + Intergenic
1024863499 7:53874939-53874961 CTGGGGACTCAGAGGCAGGAAGG + Intergenic
1024932683 7:54680391-54680413 CTGGGGACACAGAAGGTGGTGGG - Intergenic
1026329372 7:69338443-69338465 TTGGGGAGACAGGGGGAGTGAGG + Intergenic
1028960225 7:96740327-96740349 CTGGGGTGACAGAGGGAGTTAGG + Intergenic
1032383628 7:131506835-131506857 CTGGGGCTAGAGAGGGAGGCAGG - Intronic
1032452229 7:132042906-132042928 GTGGGGAAACAGTGGGAGGCAGG + Intergenic
1032496749 7:132368532-132368554 CTGGGCAGACAGAGGGTGACAGG - Intronic
1033242552 7:139692353-139692375 CTGGCTACAGAGAGGGTGTCAGG + Intronic
1033256565 7:139806653-139806675 CAGGAGACAGAGAGGGAGACAGG - Intronic
1033898869 7:146111460-146111482 CTGGTTACAGAGAGGCAGTCAGG - Intergenic
1034256526 7:149727759-149727781 CTGGGGCAACAGAGGGAGCCGGG - Intronic
1034263825 7:149772306-149772328 CTGGGGAGACAGAGGGGGAAGGG - Intronic
1034347520 7:150396668-150396690 CTGGGGGGACAGGAGGAGTCTGG + Exonic
1034559493 7:151871005-151871027 TTGGGGACACTGAGGCAGGCTGG - Intronic
1034972205 7:155426444-155426466 CTTGGGACAAGGAGGGATTCTGG - Intergenic
1035374955 7:158401786-158401808 CTGGGAAGACAGAGGGGCTCAGG + Intronic
1035614036 8:989229-989251 CTGGGAACCCAGAGGGACTCCGG - Intergenic
1035754753 8:2022912-2022934 CGGGGCAGACAGAGGGAGGCAGG - Intergenic
1036226146 8:6959402-6959424 CTGGGGATACAGAGAGCATCAGG + Intergenic
1037192430 8:16142824-16142846 CTGGGAATACAGAGGGAGGGAGG + Intronic
1037788093 8:21914618-21914640 CTGAGGTCACAGAGGTAGTTGGG + Intergenic
1037939015 8:22936587-22936609 CTGGCTTCACAGAGTGAGTCAGG - Intronic
1037974645 8:23200761-23200783 CTGGGTACACACAGGGAGGGAGG + Intronic
1038973092 8:32659710-32659732 CTGGGGAGACAGCTGGAGTTAGG - Intronic
1039475130 8:37835616-37835638 CTGGGGGCACCGGGGGAGCCAGG - Exonic
1039836528 8:41260608-41260630 CAAGGGACACAGAGGTAGGCTGG - Intergenic
1040124435 8:43720912-43720934 CTGGGGACACAAGGGTGGTCAGG + Intergenic
1040538079 8:48327027-48327049 CTGGGGACACAGAGGTTGCCTGG - Intergenic
1040899604 8:52404378-52404400 CTGCTGAGACAGAAGGAGTCGGG + Intronic
1041185372 8:55294652-55294674 CTGGAGACAGTGAGGGAGTAAGG - Intronic
1041277492 8:56177884-56177906 CTGGGGACACAGAAGCAGTACGG - Intronic
1041414961 8:57597812-57597834 CTGGGGGCACTGTGGGAGCCAGG - Intergenic
1044924132 8:97195449-97195471 CTCTGGACACAGAGTGAGGCTGG + Intergenic
1045033683 8:98161479-98161501 CTGAGGACACAGAGGAATACAGG + Intergenic
1045573422 8:103393402-103393424 GTGGGCATACAGAGGGAGTCAGG - Intergenic
1046199875 8:110911143-110911165 CTGGGGATACAGAGGGCGGGGGG + Intergenic
1047337304 8:123949042-123949064 CTGGGGAAACAGAGGAACCCAGG - Intronic
1047487503 8:125345091-125345113 CTGGGGACATAGATGGTTTCTGG + Intronic
1048509458 8:135049165-135049187 ATGGAGACACAGAGTTAGTCTGG - Intergenic
1048996030 8:139794197-139794219 CTGGGACCACAGTGGGAGCCAGG - Intronic
1049157152 8:141074074-141074096 CTGGGGACACAGAGGTGGATGGG + Intergenic
1049250667 8:141587254-141587276 CTGGGGACACAGAGGTTGGCAGG + Intergenic
1049427976 8:142545721-142545743 CTGGAGACACAGAGGGAAGCAGG - Intergenic
1049511458 8:143028741-143028763 GTGGGGACACAGAGACAATCAGG + Intergenic
1049534005 8:143169646-143169668 CTGGGCACACAGTGAGGGTCAGG + Intergenic
1049557394 8:143289769-143289791 GTGGGCATACAGAGGCAGTCGGG + Intronic
1049588193 8:143441470-143441492 CTGGCAGCACAGAGGGAGCCCGG + Intronic
1049778628 8:144417559-144417581 CAGGGGCCACCGAGGGTGTCTGG - Intergenic
1050530111 9:6581261-6581283 TTGGGGGCACTGAGGGAGACTGG - Intronic
1051057215 9:13001774-13001796 TTGAAGACACAGAGGGAGCCAGG - Intergenic
1051730636 9:20139286-20139308 CTGAGGACTCACAGGGAGTAAGG - Intergenic
1053196876 9:36126438-36126460 CTGTGGTTACACAGGGAGTCAGG + Intergenic
1053480761 9:38414754-38414776 ATGGGGAGGCAGAGGGAGTGGGG - Intronic
1054451492 9:65405684-65405706 CTCTGGACTCAGAGGGAGCCAGG + Intergenic
1055024379 9:71703731-71703753 ATGGGGACATAGAGTGTGTCAGG - Intronic
1055467650 9:76581769-76581791 CTGGGTACTCAGAGGGTGGCTGG - Intergenic
1057196962 9:93120786-93120808 GCGGGGACACAGAGGCAGTGCGG + Intergenic
1057210521 9:93198770-93198792 GTGGGGGCCCAGAGGCAGTCTGG - Intronic
1057221132 9:93258592-93258614 CTGGGGGCTCTGAGGGAGTCAGG - Intronic
1057576445 9:96246464-96246486 CTGGGGACACAGAGTCCATCTGG - Intronic
1058528864 9:105886365-105886387 CAGGAGACACAGAGGCAGTTGGG - Intergenic
1059239615 9:112792905-112792927 ATGGGAACACAGAGTAAGTCTGG + Intronic
1059399535 9:114060271-114060293 CTGTGGACACAGAGAGACTCAGG + Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1060387215 9:123242001-123242023 CTAGGGACACAGTGGGTGTGTGG - Intronic
1060406656 9:123376219-123376241 CTGGAGGTACAGAGGGAGGCTGG + Intronic
1060522149 9:124300057-124300079 CTGAGGACACAGAGGGAGAAGGG + Intronic
1060821293 9:126662842-126662864 CCGGGGACATATAGGGAGCCTGG + Intronic
1060872359 9:127053085-127053107 CTGGGGTCACTGACGGAGTGAGG - Intronic
1060916226 9:127392685-127392707 TGGAGGAAACAGAGGGAGTCAGG + Intronic
1061404589 9:130386296-130386318 CTGGGGAGCCAAAGGGAATCAGG - Intronic
1061450790 9:130665995-130666017 CTGGGAGCAGAGAGGGACTCGGG + Intronic
1061864274 9:133484564-133484586 CTGGGCACACAAAGGGTGTCTGG + Intergenic
1062035891 9:134382372-134382394 CTGGGGAGACAGTGGGGGCCAGG + Intronic
1062277799 9:135738987-135739009 GTAGGGACACAGAGGGGCTCAGG - Intronic
1062370423 9:136236007-136236029 CTTCGGACCCAGAGGGAGACTGG - Intronic
1185823746 X:3229022-3229044 ATGGGGAAACAGGGGGAGTAAGG + Intergenic
1186693701 X:12006649-12006671 CTGTGGAGAAGGAGGGAGTCTGG - Intergenic
1186775050 X:12856177-12856199 CTGGGGACAGAGCGAGACTCTGG + Intergenic
1187575328 X:20547784-20547806 CTGGGGAGAGAGAGGGAGTGAGG + Intergenic
1187768661 X:22670944-22670966 CAGGGGACCCAAAGGGTGTCTGG + Intergenic
1188270968 X:28139791-28139813 TTGGGGACAGGGAGGGGGTCAGG + Intergenic
1190069358 X:47266702-47266724 CATGGGTCACAGAGGGACTCAGG - Intergenic
1190266813 X:48831742-48831764 CTGGGGCCTAAGAGGGAGTGAGG - Intronic
1190334969 X:49256856-49256878 CTGGGGGGACAGAGGGTGTCAGG + Intronic
1190491886 X:50990624-50990646 CTGAGGGCAGAGAGGGAGGCAGG - Intergenic
1190501276 X:51081056-51081078 CTGAGGGCAGAGAGGGAGGCAGG + Intergenic
1191965588 X:66753634-66753656 CTAGGGACACTCAGGGATTCAGG - Intergenic
1192025173 X:67442428-67442450 TGGGAGACACAGAGGGATTCTGG + Intergenic
1192107911 X:68333921-68333943 GTGGGGACAGAGAGAGACTCTGG - Intronic
1192511427 X:71722654-71722676 AGGGAGACACAGAGGGAGTATGG - Intergenic
1192515270 X:71758851-71758873 AGGGAGACACAGAGGGAGTATGG + Intergenic
1195704574 X:107729647-107729669 CTGGGCCGACAGAGGGAGGCAGG + Intronic
1196276485 X:113771774-113771796 TTGGGGATACAGAGGTAGTATGG - Intergenic
1198115456 X:133540547-133540569 CAGGGGACAGAGTGGGAGTGAGG + Intronic
1199714351 X:150495669-150495691 CTGGGGACACAGAGTCAGAGAGG + Intronic
1200079113 X:153566794-153566816 CAGGGGACGCAGCGGGAGTTGGG - Intronic
1201684895 Y:16690204-16690226 CTGTGGACACACAAGGAGTGAGG - Intergenic