ID: 1076765942

View in Genome Browser
Species Human (GRCh38)
Location 10:132633131-132633153
Sequence CACAAAAGGCAGCCAGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 373}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076765942_1076765951 18 Left 1076765942 10:132633131-132633153 CCTGTCCCTGGCTGCCTTTTGTG 0: 1
1: 0
2: 1
3: 27
4: 373
Right 1076765951 10:132633172-132633194 CAGCTTCAGTAGTGAGCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076765942 Original CRISPR CACAAAAGGCAGCCAGGGAC AGG (reversed) Intronic
900278218 1:1847131-1847153 CACTGAAGGCAGGCAGGGAGAGG + Intronic
900351869 1:2238851-2238873 CCCAGAAGGCAGCCTGGGGCAGG - Intronic
900537971 1:3188182-3188204 CACACCAGGCAGGGAGGGACAGG - Intronic
901460461 1:9388161-9388183 CACAGCTGGCAGGCAGGGACTGG + Intergenic
901732460 1:11290153-11290175 AAATAAAGGCAGCCAGGCACGGG - Intronic
901743540 1:11357723-11357745 GAGAAAAGGCAGCCAGGGAAGGG + Intergenic
902276877 1:15346182-15346204 CACAGGAGGCAGCCAGGGCCAGG - Intronic
902515691 1:16988302-16988324 CAGGTAAGGCAGGCAGGGACCGG - Exonic
902562508 1:17286627-17286649 CAGAAACGGCAGTCAGGGCCTGG - Intergenic
902590004 1:17466987-17467009 CAGAAATGGGAGCCAGGGCCAGG - Intergenic
902623850 1:17665508-17665530 CAGAAAAGCAAGCCAGGGAAAGG - Intronic
902790659 1:18765653-18765675 AAGAAAAGAGAGCCAGGGACTGG + Intergenic
903191020 1:21656034-21656056 CACAAGAGGCTGCCTGGGCCAGG - Intronic
903571924 1:24311959-24311981 AACAGGAGGCAGCCAGGGAGAGG - Intergenic
903686685 1:25136905-25136927 CACAAAAGCCAGCCTGGACCAGG + Intergenic
904123959 1:28223068-28223090 CACAAAGGGCAGCCAAGCATGGG + Intronic
904771519 1:32883946-32883968 CACAAGAGGCTTCCAGGGTCAGG + Intergenic
905457793 1:38100488-38100510 CCCAGGAGGCTGCCAGGGACAGG - Intergenic
905939054 1:41848555-41848577 CACAATAGGAAGCGAGGGAGGGG + Intronic
906352805 1:45078666-45078688 CACAGATGGTAGCCAGGGAGTGG - Intronic
906733691 1:48104590-48104612 CACATAAGGCAGCCACTGTCAGG - Intergenic
906866828 1:49430275-49430297 CAGAGAAGGGAGCCTGGGACAGG - Intronic
907161788 1:52376215-52376237 CACAAAAATTAGCCAGGGTCTGG + Intronic
909500800 1:76333056-76333078 CACTAATGGCAGGCAGGGAATGG - Intronic
910062713 1:83112928-83112950 CAAAAATGGCTGCCAGTGACTGG - Intergenic
910217151 1:84854098-84854120 GACATAAGGGAGCCAGAGACTGG - Intronic
911050691 1:93668453-93668475 CACCAGAGGCCACCAGGGACCGG + Intronic
911145316 1:94546793-94546815 CATCAAAGGCAGCAAGGGATTGG - Intergenic
912495308 1:110087966-110087988 CACAGAAGACACCCTGGGACAGG - Intergenic
913257867 1:116971679-116971701 CTCACAAGGCAGACAAGGACTGG - Intronic
919490272 1:198197926-198197948 CACAGGAGGCATCCAGGGGCAGG + Intronic
920182563 1:204141469-204141491 CAAAAAAGGTAGCCAGTGAAAGG + Intronic
920541990 1:206785626-206785648 CAGAGAGGGCAGCCAGGGAGAGG + Intergenic
920869068 1:209778229-209778251 CACAAAAGGCACCCAGAGTAGGG + Intronic
923276015 1:232397005-232397027 CAAAATTTGCAGCCAGGGACTGG - Intergenic
923595268 1:235356363-235356385 TACAAAAGTTAGCCAGGGGCTGG + Intergenic
924266622 1:242289236-242289258 AAAAAAAGGCAGCCAAGGAAAGG - Intronic
924606097 1:245536882-245536904 CAAGAAAGGAAGCCAGGGAGAGG + Intronic
1063010067 10:2012735-2012757 CAGCAAAGGCAGCCCAGGACAGG - Intergenic
1063470370 10:6279885-6279907 CACAGCATGCAGCCAGGGTCAGG - Intergenic
1065903360 10:30227410-30227432 CAAAAAAGGCAGCACAGGACAGG + Intergenic
1066718211 10:38309323-38309345 GAAAAAAGGCAGCCAAGGAAAGG + Intergenic
1066991830 10:42522540-42522562 CACAAAAATCAGCCAGGCATGGG + Intergenic
1067060553 10:43076078-43076100 CTCAAAAAGCAGCCGGGGATGGG + Intergenic
1067655035 10:48185425-48185447 CAGAAAAGGCAGACTGGGAGAGG + Intronic
1069582697 10:69576380-69576402 CGCAAAAAGCAGCCAGGGCGAGG + Intergenic
1070214171 10:74359044-74359066 TACAAAAGGAAGGCAGAGACAGG - Intronic
1070644908 10:78195169-78195191 CACAAAGGGCACCCTGGGAGGGG + Intergenic
1071118264 10:82249034-82249056 TACAAAAGGCATCAAGGGTCTGG - Intronic
1072404216 10:95134350-95134372 AAGAAAAGGCTGCCTGGGACTGG - Intergenic
1072993779 10:100224730-100224752 AACAAAAGTCAGCTAGGGCCGGG - Intronic
1073120673 10:101121040-101121062 GGCAAAGGGCAGCCAGCGACTGG + Intronic
1073523282 10:104155195-104155217 CACCCAGGGCAGCCAGTGACCGG - Intronic
1073550255 10:104393542-104393564 CACTGAAGGCAGCCAGGGGCAGG + Intronic
1073887760 10:108060526-108060548 CACAAAAGGAAGACAAAGACAGG + Intergenic
1074635201 10:115307414-115307436 CACAAAAATCAGCCAGGCATGGG - Intronic
1075088885 10:119431746-119431768 CACAGCAGGGAGCCAGGCACTGG - Intronic
1075894663 10:125984465-125984487 CACAGGAGGCACCCAGGGTCTGG + Intronic
1076244510 10:128936023-128936045 CACTGAAGGCAGCCTGGGTCGGG - Intergenic
1076480847 10:130784425-130784447 CACAAAAGGAAGACGGGGGCAGG + Intergenic
1076499347 10:130924240-130924262 CACGAAAGGGAGGCAGGGAGAGG - Intergenic
1076572244 10:131440583-131440605 CACAGGTGGCAGCCAGGGGCTGG + Intergenic
1076765942 10:132633131-132633153 CACAAAAGGCAGCCAGGGACAGG - Intronic
1076765956 10:132633202-132633224 CACTAAAGGGAGCCAGGCAGGGG - Intronic
1077595393 11:3527387-3527409 GAAATAAGGCAGCCAGGGGCAGG + Intergenic
1078581558 11:12543065-12543087 CAGAAAAGAAAGCCAGGGGCTGG - Intergenic
1078666311 11:13328526-13328548 CTCAAAAGCCAGGCAGGGAGTGG - Intronic
1081741680 11:45445304-45445326 CACAAAAGGCTGCCTGGCAATGG - Intergenic
1081913968 11:46719271-46719293 TACACAGGGCAGCCAGGGCCAGG - Exonic
1082224237 11:49683568-49683590 AACAAAAGGCAGCTTGGCACAGG - Intergenic
1082881338 11:58041199-58041221 CACACAAGGCTGCCTGGGTCAGG + Intronic
1083782118 11:64924124-64924146 CACCATAGACAGCAAGGGACGGG + Intronic
1084150058 11:67283934-67283956 CACAAAAGGAATCAAGGTACTGG + Exonic
1084251294 11:67901363-67901385 GAAATAAGGCAGCCAGGGGCAGG + Intergenic
1084545122 11:69811514-69811536 CACAAAAAGCAGGAAGGGAAGGG + Intronic
1084821550 11:71694672-71694694 GAAATAAGGCAGCCAGGGGCAGG - Intergenic
1085380167 11:76109284-76109306 CAGCAAAGGCAGCTATGGACAGG - Intronic
1085504013 11:77045796-77045818 GACAAATGGCAGCTAGGGGCAGG - Intergenic
1085989452 11:81824140-81824162 CACAAAAGGCAGTCAGGAAGAGG + Intergenic
1086624809 11:88935626-88935648 AACAAAAGGCAGCTTGGCACAGG + Intronic
1088631115 11:111774795-111774817 CAGGAAAGACAGCCAGGGCCAGG - Intergenic
1090406791 11:126480823-126480845 CACAAAAGGCAGCAAAGAGCTGG - Intronic
1090719649 11:129459770-129459792 CACAAAAGGTAGCTAGAGCCTGG + Intergenic
1090812954 11:130263281-130263303 GACACTAGACAGCCAGGGACTGG + Intronic
1091346574 11:134858182-134858204 CACTGACGGCAGCCTGGGACAGG + Intergenic
1092090253 12:5798215-5798237 CATGAAAGGCAGCCAGGGGACGG + Intronic
1092421552 12:8336161-8336183 GAAATAAGGCAGCCAGGGGCAGG + Intergenic
1092594491 12:9986513-9986535 CATAAAAGGCAGCAAGGGTTGGG + Intronic
1095259189 12:40079369-40079391 CACAAAAGTCATTCAGGGACAGG + Intronic
1095517293 12:43020822-43020844 CCACAAAGGCAGCCAGGCACGGG + Intergenic
1096137274 12:49212878-49212900 CACAGAAGGCAGACAGACACAGG + Intronic
1096844280 12:54396979-54397001 CTCAAGAGGCAGCCATGGCCAGG - Intronic
1098050968 12:66452255-66452277 CAGCACAGGCAGCCAGGGAAAGG + Intronic
1098241231 12:68469096-68469118 CACAAAAGGGAGCCACTGAAGGG + Intergenic
1100053905 12:90485751-90485773 CATAGAAGGCAGCAAGGGACAGG + Intergenic
1103036121 12:117658156-117658178 CACAGGAGCCAGCCAGGGTCTGG + Intronic
1104788119 12:131464214-131464236 CACTGAAGGCAGGCAGGGAGAGG + Intergenic
1104803801 12:131572245-131572267 GACCAAAGGAAGCCAGGGATGGG - Intergenic
1106138710 13:26993212-26993234 CCCAAAATGCAGGGAGGGACTGG + Intergenic
1106902105 13:34364252-34364274 GACAAAAGGAAGACAGGGAAAGG + Intergenic
1106904322 13:34389105-34389127 CGCAAGATGCAGGCAGGGACTGG + Intergenic
1107948062 13:45437481-45437503 CACAAAAGGAAGCCACTGAAAGG + Intergenic
1107975428 13:45683847-45683869 GACAGAAGGCAGCCTGGGAGAGG - Intergenic
1108570012 13:51740418-51740440 GAAAAAAGGAAGCCAGGGCCGGG + Intronic
1111230570 13:85340687-85340709 CAGAAAGGGCAGCCAGGCAGAGG + Intergenic
1111545625 13:89731444-89731466 CACAAAAGGCAGACAAAGAGTGG - Intergenic
1112253716 13:97808228-97808250 CACTCATGGCAGCCGGGGACAGG - Intergenic
1112555225 13:100461708-100461730 CTGCAAAGGCAGGCAGGGACAGG - Intronic
1113598144 13:111548632-111548654 CCCAGAAGCCAGCCAGGAACAGG - Intergenic
1113616119 13:111681697-111681719 CCAAAAAGGCACCCATGGACAGG - Intergenic
1113621587 13:111766590-111766612 CCAAAAAGGCACCCATGGACAGG - Intergenic
1114052716 14:18935105-18935127 CACAAAAGTCACCCTGGGAAGGG - Intergenic
1114109842 14:19466821-19466843 CACAAAAGTCACCCTGGGAAGGG + Intergenic
1114134996 14:19837416-19837438 CCCAAAAGTCAGCCAGGAGCAGG - Intergenic
1114186375 14:20405498-20405520 CAAAAATGGCAGCCAGGGTGGGG + Exonic
1114485257 14:23057951-23057973 CCCAAAAGCCAGCCGGGAACCGG - Intergenic
1114516108 14:23301383-23301405 CACCAAAGGCACCCGGGGGCGGG - Exonic
1116076887 14:40122107-40122129 CACAAAACTCAGTCTGGGACTGG + Intergenic
1118271255 14:64344537-64344559 CCCAAAAGACAGCCATGGGCCGG + Intergenic
1118794645 14:69130178-69130200 CTCAAAAGCCAGCCAAGCACAGG + Intronic
1118978676 14:70699018-70699040 CACAAAAGACAGCCAAGAACAGG + Intergenic
1120771487 14:88385168-88385190 GATAAAAGGGAGGCAGGGACAGG + Intronic
1120837002 14:89048798-89048820 CACAAAAGGCAGACAAAGAGTGG + Intergenic
1121867849 14:97379379-97379401 CCCAAGAGGAAGCCAGGGGCTGG - Intergenic
1122130034 14:99599592-99599614 TACCAAAGGCAGCCAAGGCCAGG + Intronic
1122783265 14:104152700-104152722 CTCAAAAGACAGACAGGGAGGGG - Intronic
1123038672 14:105481605-105481627 CACACAAGGAAGCCTGGGCCTGG - Intergenic
1123476967 15:20597347-20597369 CACAAGCTGCAGCCAGGGGCAGG + Intergenic
1123641044 15:22403017-22403039 CACAAGCTGCAGCCAGGGGCAGG - Intergenic
1124595100 15:31085814-31085836 CACAGACAGCAGCCAGGGTCAGG + Intronic
1128419481 15:67478086-67478108 CAGAAAAGGCAGACAGAGGCTGG + Intronic
1128764242 15:70241428-70241450 CACAAAAGGCTCAGAGGGACAGG + Intergenic
1128931777 15:71710840-71710862 AACAAAATGCAGCCTGGTACAGG + Intronic
1129501158 15:76038763-76038785 CATAAGTGGCAGCCAGGTACTGG + Intronic
1130017009 15:80195407-80195429 CACAAATGGCAGGGAGGGGCAGG - Intergenic
1130313112 15:82771796-82771818 CACACAGGGCAGCCAGAGACTGG + Intronic
1130685356 15:86032353-86032375 CACCACACGCAGCCAGGGGCAGG - Intergenic
1130965345 15:88693489-88693511 CACAACAAGCAGCAAGGGGCAGG + Intergenic
1131146144 15:90013975-90013997 CACAACAGTGAGCCAGGAACTGG - Intronic
1131463624 15:92637418-92637440 CACCAAAGCCAGCCGGGGCCAGG + Intronic
1131629557 15:94161806-94161828 GGCAAAAGGCAGTCAGGGGCAGG - Intergenic
1131744875 15:95436528-95436550 CACGAAATTCAGCCAGGCACTGG + Intergenic
1132072162 15:98787861-98787883 CACAAAGGGCCTCCAGGCACAGG - Intronic
1132088728 15:98929865-98929887 CAGAAAAGCCAGCCAGGGGAAGG - Intronic
1132651773 16:1024415-1024437 CACAGAAGGCACTCAGGGAGGGG + Intergenic
1133056301 16:3147189-3147211 CACAGAGGGCAGCCAGTGGCTGG + Intronic
1133094723 16:3435369-3435391 CACTGCAGGCAGCCAGGGAAAGG - Exonic
1133192541 16:4145114-4145136 CACAAAAATCAGCCAGGCGCGGG + Intergenic
1133337635 16:5016293-5016315 CCCAAAAGGCAGCCAGTCAGGGG + Exonic
1133402972 16:5502297-5502319 CACAGAAGTCACACAGGGACGGG - Intergenic
1133977443 16:10609406-10609428 CACAGAAGGCAGGCAGGGTCCGG + Intergenic
1133989934 16:10696914-10696936 CACAGAAGGCAGCCAAGAAATGG + Intergenic
1134322962 16:13180368-13180390 CACCAAGGTCAGCCATGGACAGG - Intronic
1136929909 16:34409638-34409660 CAAAACAAGCAGCCAGGGCCTGG + Intergenic
1136974665 16:35002167-35002189 CAAAACAAGCAGCCAGGGCCTGG - Intergenic
1137634008 16:49969831-49969853 AACAAAAGGCAGCAAGGGTTAGG - Intergenic
1137984169 16:53093892-53093914 CACAAAAGAGAACCAGGGACTGG + Intronic
1140232723 16:73131045-73131067 AACAAGAGCCAGCAAGGGACAGG - Exonic
1140908595 16:79430777-79430799 TGTAAAAGGCAGACAGGGACTGG - Intergenic
1141174642 16:81710848-81710870 CAGCAAAGGCTGACAGGGACAGG - Exonic
1141581841 16:85004612-85004634 CAGAACAAGCAGCCAGGGAGAGG - Intronic
1141605225 16:85149273-85149295 CACAAGTGGCATTCAGGGACTGG + Intergenic
1141607300 16:85161546-85161568 CACAAAATGCAGCCTGGGTGTGG - Intergenic
1141990183 16:87604852-87604874 CAGAAAAGGCCGCCTGAGACCGG - Intronic
1143647604 17:8241322-8241344 CACAAAAAGCAGGCAGGGGCTGG + Intronic
1146285862 17:31573867-31573889 CACAAAAGACAGCCAGCTGCTGG - Intronic
1146388818 17:32401956-32401978 CACAAAAATTAGCCAGGCACGGG - Intergenic
1146485638 17:33240403-33240425 AACAAAAGGCAGCCACTGGCTGG - Intronic
1146721070 17:35123871-35123893 CACAGAAGGCCGCTAGGCACTGG - Intronic
1146815006 17:35935634-35935656 CACAAAAAGCAGCCTGGGACAGG + Intronic
1146940319 17:36839711-36839733 CACAAATAGCAGTCAGGGCCAGG - Intergenic
1147377633 17:40032376-40032398 CAGTAAAGGGAGCCAGGGAAAGG - Intronic
1147381515 17:40059078-40059100 CAAAAGAGGGAGCCAGGGAAGGG - Intronic
1148151935 17:45402218-45402240 CACAGTAAGCAGCCAGGGACAGG + Intronic
1148332699 17:46821642-46821664 CAGAAGAGGCAGCAAGGGCCAGG + Intronic
1150221416 17:63497636-63497658 CTCACAGGGAAGCCAGGGACAGG + Intronic
1150671035 17:67197477-67197499 CACAAAATACAGGCAGGGAAAGG - Intronic
1151474599 17:74338527-74338549 CACATGAGGCTGCCAGGGTCAGG + Intronic
1151650802 17:75468292-75468314 CAGAGAGGGCAGCCAGGAACAGG - Intronic
1152128349 17:78460956-78460978 CAAAAAAAGCACCCAGGGAGGGG + Intronic
1152133936 17:78493144-78493166 CATAAAAGGCATCCAGGGCCGGG - Intronic
1152199952 17:78939528-78939550 AACAGAAGGCAGTCAGGGGCTGG + Intergenic
1152250312 17:79209113-79209135 CAGAAAGAGCAGCCAGGGGCCGG - Intronic
1153601332 18:6783753-6783775 CACAAGAGGCAATCAGGGACTGG + Intronic
1155645309 18:28070506-28070528 CACAAAAAGGAGACAGGGAGAGG + Intronic
1155969889 18:32072504-32072526 CATAAAAGGAATCCAGGCACAGG - Exonic
1156020840 18:32597789-32597811 CACAACAGGCAGGCAGGGAGGGG + Intergenic
1156537042 18:37874085-37874107 ATAAAAAGGCAGCCAGGCACGGG - Intergenic
1157483482 18:48070827-48070849 CTCAAAAGGAAGCCAAGGAAAGG - Intronic
1158674578 18:59506676-59506698 CCCAACAGGAAGCCAGGGGCAGG + Intronic
1160059467 18:75516189-75516211 AACATCAGGCAGCCAGGGAAAGG + Intergenic
1160548482 18:79678445-79678467 CAAAAAAGGGGGCCAGGGAGTGG - Intergenic
1160602611 18:80025429-80025451 AACAAAAGGCAGGCAGGAATCGG + Intronic
1160718103 19:585499-585521 CACCAAGAGCACCCAGGGACGGG - Intergenic
1161272695 19:3398736-3398758 TACATAAGGCAGCGAGGCACAGG - Intronic
1161282372 19:3452937-3452959 AACACAAGGCAGGGAGGGACTGG + Intronic
1161577063 19:5060141-5060163 GACAAAAGGGAGCCATGGGCCGG + Intronic
1161625532 19:5324422-5324444 CACAAAATGCTCCCAGGCACAGG - Intronic
1162230361 19:9260907-9260929 TAGAAAAGGCAGCAAGGGGCCGG - Intergenic
1162784942 19:13028754-13028776 CAGAACAGGTGGCCAGGGACGGG + Intronic
1163069591 19:14828025-14828047 CACAAATGTCAGCAAAGGACAGG + Exonic
1163228398 19:15980602-15980624 TCCAAAAGCCAGCCAGGGAGGGG + Intergenic
1163665768 19:18603601-18603623 CAGAGATGGCAGCCAAGGACAGG + Intronic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1165243917 19:34487088-34487110 AAAAAAAAGCAGGCAGGGACTGG - Intronic
1165928247 19:39340944-39340966 TGCAAAAGGCAGCCAGAGAGAGG - Intronic
1166144765 19:40826368-40826390 CTCAAAGGGCAGCCAGGTCCGGG + Intronic
1166182977 19:41121839-41121861 CTCAAAGGGCAGCCAGGTCCGGG - Intronic
1166649900 19:44564833-44564855 CACAAATGGCAGATAGGCACAGG + Intergenic
1166982353 19:46638843-46638865 CACGGCAGGGAGCCAGGGACCGG + Intergenic
1167345146 19:48940842-48940864 CACAAAAAGGAGACAGGGTCTGG - Intronic
1167804256 19:51768856-51768878 AAGAAAAGTCAGCCAGGGCCAGG - Exonic
1167809669 19:51817787-51817809 CTCGACAGGAAGCCAGGGACTGG + Intronic
1168350598 19:55673837-55673859 CACTGAAGGCAGGAAGGGACAGG - Intronic
925128865 2:1480601-1480623 CACACGAGCCAGCCAGGGCCAGG + Intronic
925329013 2:3043893-3043915 CAGAAAAGGCAGCGAGGGTATGG + Intergenic
926608053 2:14917403-14917425 CATCAAAGCCAGCCAGAGACAGG + Intergenic
927504307 2:23603246-23603268 CAGAAAAGGCAGCCAGAGGTAGG + Intronic
927519696 2:23691282-23691304 CACCCAAGGCAGGCAGGGCCGGG + Intronic
929297071 2:40260266-40260288 CACAAAAGGGAACCAGGGAAGGG + Intronic
929941222 2:46335572-46335594 CACAAAAGGCAACCAAGAAGGGG - Intronic
932041464 2:68304096-68304118 CAAAAAAGCCAGCCAGGTGCAGG + Intronic
932416083 2:71574664-71574686 CACACCAGCCAGCCAGGCACAGG - Intronic
932620851 2:73264252-73264274 CACAGAAGGCAGGCAGGGGCAGG + Intronic
934165497 2:89290419-89290441 CACAGAAGGCAGTCAGTGATAGG + Intergenic
934201777 2:89892043-89892065 CACAGAAGGCAGTCAGTGATAGG - Intergenic
934562794 2:95321682-95321704 AACAAAAGGCACACAGAGACAGG + Intronic
937483893 2:122293477-122293499 CACAAGAAAGAGCCAGGGACAGG - Intergenic
937841448 2:126528274-126528296 CACAAGGGGGAGCCAGGTACAGG + Intergenic
938091492 2:128437489-128437511 CTGGAAAGGCAGCCAGGGGCTGG + Intergenic
939228390 2:139393427-139393449 GACAAAAGGCAGCTTGGCACAGG + Intergenic
940512397 2:154634499-154634521 AACCAAAGGCAGTCAGGGAAGGG - Intergenic
943978001 2:194508514-194508536 CACCACAGGCAGCCTGGGCCAGG - Intergenic
945219989 2:207473669-207473691 AACAAAAAGCCACCAGGGACAGG - Intergenic
946622343 2:221573221-221573243 CAGACAAGGCAGACCGGGACTGG + Intronic
947806055 2:232968861-232968883 GAGAAAAGCCAGCCAGGGAAGGG - Intronic
948719944 2:239893155-239893177 CCCAAAAGGAAGCCAGGGCAGGG + Intronic
948827380 2:240579227-240579249 CACACATGGCAGCCAGGAAGTGG + Exonic
948955767 2:241289685-241289707 CTCCAAAGGCATCCAAGGACAGG + Intronic
1169208902 20:3754825-3754847 CCCAAAAGGAAGGCAGGGAGAGG + Intronic
1169575397 20:6954560-6954582 CATAAAAGGCAGCCAGTCCCAGG - Intergenic
1170460225 20:16570862-16570884 AAGAAAAGGGAGCCAGGGATTGG - Intronic
1170738105 20:19028031-19028053 CCCAACAGGCAGCCCGGGTCGGG + Intergenic
1171027086 20:21640670-21640692 CCCAAAAGGCTTCCAGGGGCTGG - Intergenic
1171356074 20:24546553-24546575 CGCAAAATGAAGCCTGGGACAGG - Intronic
1171398196 20:24853666-24853688 CAAAAAAAGTAGCAAGGGACAGG - Intergenic
1171994211 20:31719786-31719808 AACAAAAGGCAGTCTGGGAGAGG - Intronic
1172468395 20:35173872-35173894 CAGAAAAGGCAGCAGGGGCCAGG + Intronic
1172782355 20:37444384-37444406 CCCAAAAGGAAGCCAGGTGCAGG - Intergenic
1174916006 20:54654646-54654668 CAAAAAAGGCAGGCAGGGTGAGG + Intergenic
1175132643 20:56801091-56801113 CAGAAAAGGCAGCCTTGGCCAGG - Intergenic
1175960316 20:62632925-62632947 CACAAAAGCCAGCCAGCGTTGGG + Intergenic
1176205875 20:63887864-63887886 CACTGCAGGCAGCCAGGGTCAGG - Intronic
1176673895 21:9759069-9759091 CACAAAAAGAAGCCAGGCATGGG + Intergenic
1178495209 21:33080509-33080531 CAGAAATGACAGCCAGGCACTGG + Intergenic
1179152353 21:38819811-38819833 CTCGAAAGGAAGCAAGGGACAGG - Intronic
1179553798 21:42159962-42159984 CTCCAAAGGCAGGCAGGGGCAGG + Intergenic
1180108579 21:45636945-45636967 CCCAAAGGGCCGCCAGGCACAGG + Intergenic
1180135857 21:45861303-45861325 CAGAACAGGCAGGCAGGGCCTGG - Intronic
1180187624 21:46147258-46147280 CCCAAAGGGAAGGCAGGGACTGG - Intronic
1180471190 22:15657479-15657501 CACAAAAGTCACCCTGGGAAGGG - Intergenic
1180733655 22:18000680-18000702 CTCGGAAGGCAGCCAGGGAAGGG + Intronic
1183317370 22:37144103-37144125 CCCAAGAGGTAGCCAGGGGCAGG + Exonic
1183675809 22:39298278-39298300 CAGAGAAGGCAGGAAGGGACAGG + Intergenic
1184165769 22:42726746-42726768 CACAACACCCAGCCAGAGACTGG + Intergenic
1184391582 22:44206380-44206402 CGCAGAAGGCACACAGGGACAGG + Exonic
1184944072 22:47788571-47788593 CCCAACAGGCAGGCAGAGACGGG + Intergenic
952338680 3:32427167-32427189 CATAAATAGCAGCCAGGGAGTGG - Intronic
952651698 3:35735406-35735428 AACAAAAGGGAGCAAGGGACAGG - Intronic
953044532 3:39282621-39282643 CACACAATGCAGGCAAGGACTGG + Intergenic
954582149 3:51708723-51708745 CTCAAAAGCCAGGGAGGGACAGG - Intronic
954696582 3:52430538-52430560 CAGCAAAGGTGGCCAGGGACTGG + Intergenic
956829674 3:73033705-73033727 CACAAAAGCTAGACAGGGATTGG - Intronic
957065560 3:75519112-75519134 GAAATAAGGCAGCCAGGGACAGG + Intergenic
960280428 3:115775261-115775283 CTCACAAGGCAGACAGGGCCAGG - Intergenic
961287772 3:125820309-125820331 GAAATAAGGCAGCCAGGGGCAGG - Intergenic
961899298 3:130195684-130195706 GAAATAAGGCAGCCAGGGGCAGG + Intergenic
962571592 3:136718932-136718954 AAAAAAAGGCAGGCAGGGAGGGG + Intronic
963139997 3:141939124-141939146 CACAAAAAGCAGACATGGCCAGG + Intergenic
963604652 3:147404287-147404309 CACAAAAGGCTGACAGGACCTGG - Intronic
963779545 3:149473593-149473615 CTCACAAGGAAGCCATGGACTGG - Intergenic
963810120 3:149768055-149768077 CACAAAAAGCAGCAATGTACAGG + Exonic
964293279 3:155205483-155205505 TAAAAAAGACAGCCAGGTACTGG - Intergenic
964588617 3:158336249-158336271 AAAGAAAGGCAGCCAGGGGCCGG - Intronic
967671080 3:192236115-192236137 CACAAAAGTCATTCAGGGGCAGG + Intronic
967736428 3:192957449-192957471 CACAACAGGGAGACAGTGACAGG + Intergenic
969010137 4:4055201-4055223 GAAATAAGGCAGCCAGGGGCAGG + Intergenic
969588007 4:8105665-8105687 CGCAGAAGGCAGGCAGGCACGGG + Intronic
969744090 4:9056042-9056064 GAAATAAGGCAGCCAGGGGCAGG - Intergenic
969803496 4:9588164-9588186 GAAATAAGGCAGCCAGGGGCAGG - Intergenic
970581469 4:17477646-17477668 CCCTACAGGAAGCCAGGGACAGG + Intronic
979962387 4:127036482-127036504 CACGACTGGCAGCCAGGGCCAGG + Intergenic
980803155 4:137779318-137779340 CAGAAGAGGGAGGCAGGGACCGG - Intergenic
982204882 4:152990165-152990187 CACAAAGAGCAGCGAGGGAAGGG - Intergenic
984656547 4:182324749-182324771 CACAAAAGCCTGCCACGGAAAGG + Intronic
984924506 4:184794808-184794830 CAGAAAACCCAGCCAGGCACAGG - Intronic
985396521 4:189550458-189550480 CACAAAAGGCACGCAGGCTCTGG + Intergenic
990889648 5:60634005-60634027 CAGAAGAGGCAACCATGGACAGG + Intronic
992125119 5:73631953-73631975 CACAAAATGAACCCAGGGACAGG - Intronic
992199731 5:74371321-74371343 CTCAAAAGGCAGCCAGTGAGAGG - Intergenic
992641543 5:78772488-78772510 CGCCACAGGCAGCCAGGGCCGGG - Intergenic
995750878 5:115452101-115452123 CACAAATTGCAGCCAAGGGCTGG + Intergenic
996112681 5:119583995-119584017 CACAATAGGAAGCCAGAGATGGG + Intronic
996695272 5:126387631-126387653 AACAAAAGCCTGCCAGGGCCAGG - Intronic
997695231 5:135856340-135856362 CTCAGAAGGCTGCCAGGGAGAGG - Intronic
999285291 5:150391010-150391032 CAGAAAAAGCAGCCAGTCACAGG + Intronic
999454393 5:151702783-151702805 CGGGAAAGGCAGCCAGGGAAGGG + Intergenic
1001581382 5:172800848-172800870 CTCAAAAGGCAGTGAGGGCCAGG + Intergenic
1001903192 5:175447852-175447874 CACAAGAGGCAGGGAGGGAATGG - Intergenic
1002548507 5:179969329-179969351 CAGAGAAGGCAGGCAGTGACTGG - Intronic
1003074611 6:2971927-2971949 CAAAGAAGCCAGCCAGGGGCGGG + Intronic
1004262034 6:14117398-14117420 CGCAAAAGGAAGCCGGGAACCGG - Intronic
1004611310 6:17242878-17242900 CACAAAAGGGATGCGGGGACTGG + Intergenic
1005823269 6:29615622-29615644 AAAAAAAGGCAGCCAGGCACAGG + Intronic
1006372172 6:33651952-33651974 GAGAAAAGGCAGAAAGGGACAGG - Intronic
1007009963 6:38407017-38407039 TACAAAAGACAGCCAGGTAGTGG - Intronic
1007244887 6:40453954-40453976 CACAAAAACCACACAGGGACTGG - Intronic
1007641060 6:43339978-43340000 CACAACAGGCATCCAAGGGCTGG + Exonic
1008359517 6:50598921-50598943 CTGAAAAAGCAGCCAGGGAAAGG + Intergenic
1008583128 6:52924191-52924213 CTAAAAAAGGAGCCAGGGACTGG + Intergenic
1013757674 6:113480536-113480558 CTCAGAAGACAGCCAGGAACTGG + Intergenic
1015172570 6:130270245-130270267 TACAAAAGTTAGCCAGGGCCTGG - Intronic
1015223028 6:130826346-130826368 CACTAAAGGGCGCCAGGGACAGG + Intergenic
1016851599 6:148624816-148624838 CACAGAAGGGTGCCAGGGGCAGG + Intergenic
1017500622 6:155019756-155019778 TAGAAAAGGCAGCTAGGGGCCGG + Intronic
1017693643 6:156992544-156992566 CAGAAAAGGCACCCCGGGAATGG + Intronic
1018995842 6:168709916-168709938 CAGGAAAGGCAGGCAGGGAGGGG + Intergenic
1019623048 7:2001948-2001970 CAGAAGAGGCAGCCATGCACTGG + Intronic
1021220257 7:17967455-17967477 CAAAGAAGAAAGCCAGGGACTGG - Intergenic
1022025909 7:26447761-26447783 CACAAAGTGATGCCAGGGACAGG + Intergenic
1022339979 7:29459052-29459074 CATAAAAGGGAACCAGGAACTGG - Intronic
1024242533 7:47446673-47446695 AAAAAAAGGCAGCCTGGAACAGG - Intronic
1024245018 7:47462874-47462896 CACAGAAGGCAGCCAGAAAGTGG + Intronic
1024748633 7:52436511-52436533 AACAAAAGGCAACCAGGGGGTGG + Intergenic
1025295865 7:57774947-57774969 CAGAAAAGGAAGCCAGCAACGGG + Intergenic
1025610191 7:63071160-63071182 AACAAAAGGCTGACAGGGCCTGG + Intergenic
1025961103 7:66222584-66222606 GAAAAAAGGCAGTCAGGGACAGG + Intronic
1026830918 7:73609538-73609560 CACACAAAGCGGCCAGGGCCCGG - Intronic
1027417194 7:77985800-77985822 GACAGGAGGCAGCCTGGGACAGG + Intergenic
1027600396 7:80233057-80233079 CACAAAAAGGAGCCAGGAAATGG - Intergenic
1029069244 7:97881763-97881785 GAAATAAGGCAGCCAGGGGCAGG + Intergenic
1029494467 7:100889669-100889691 CGCAATAGGCAGCCACCGACCGG + Exonic
1029807513 7:103012078-103012100 GAAAAAAGGCAGCTAGGGCCGGG + Intronic
1031084615 7:117290140-117290162 TACAGAAGGCAGACAAGGACAGG + Intronic
1031931721 7:127692507-127692529 CACAAAGGACAGCCAGGCAGAGG - Intronic
1032761125 7:134943268-134943290 CACCTAAGGAAGCCAAGGACGGG + Intronic
1032931483 7:136677604-136677626 CACAGCAGGCAGGGAGGGACAGG + Intergenic
1033309698 7:140251970-140251992 CACAAAAATTAGCCAGGGGCTGG - Intergenic
1033608935 7:142947154-142947176 CACTCAAGGAACCCAGGGACAGG + Intronic
1033664533 7:143428062-143428084 TACAAAAAGTAGCCAGGAACCGG - Intergenic
1034608716 7:152344695-152344717 CACAAAAGGCAGGCTGGGCATGG + Intronic
1035228726 7:157448306-157448328 CAGAAAATGAAGCCAGGCACAGG - Intergenic
1035364936 7:158343113-158343135 AGGAAAAGGCAGCCAGGGAGTGG + Intronic
1035781736 8:2233256-2233278 CACACAGGCCAGGCAGGGACAGG + Intergenic
1036251496 8:7166534-7166556 GAAATAAGGCAGCCAGGGGCAGG + Intergenic
1036365993 8:8120926-8120948 GAAATAAGGCAGCCAGGGGCAGG - Intergenic
1036812909 8:11879992-11880014 TCCAACAGGCAGCCATGGACCGG - Intergenic
1036884950 8:12545154-12545176 GAAATAAGGCAGCCAGGGGCAGG + Intergenic
1037537161 8:19835497-19835519 CACAATAGGCATTCAGGGAAGGG + Intronic
1037860948 8:22405214-22405236 AACAAAAGGCAGCCTGGGGCTGG + Intronic
1038177497 8:25194498-25194520 CACAAAAGCCAGCCAGGCTATGG - Intronic
1039381066 8:37085979-37086001 TAGAAAAGGCAGACAGGGGCAGG - Intergenic
1039817617 8:41108589-41108611 CAGAAATGACAGCCAGGGGCTGG - Intergenic
1041466127 8:58159277-58159299 CCCAGAAGGCAGCCAGCGAGAGG + Intronic
1042311092 8:67380035-67380057 CACAAAAATCAGCCAGGCATTGG - Intergenic
1043228317 8:77763843-77763865 CACAAATGGCAGAGAGGGAAAGG + Intergenic
1043997706 8:86839634-86839656 CACAGAAGGCAGAAAGGAACAGG - Intergenic
1044375770 8:91468548-91468570 CACTAAAAGAAACCAGGGACGGG - Intergenic
1044542090 8:93419406-93419428 CAAACATGGCAGCCAGGAACTGG + Intergenic
1044599263 8:93987439-93987461 CACAAAAGATAGACGGGGACTGG + Intergenic
1048024904 8:130577458-130577480 TACCATAGGCAGCCAGAGACGGG + Intergenic
1049380756 8:142314635-142314657 CAGAAGAGGCTGCCAGGGCCGGG + Intronic
1049465857 8:142751019-142751041 CACAGAAGGCGGGCAGGGCCGGG - Intronic
1049483106 8:142836778-142836800 CTCCAGAGGCAGCCAGGGTCAGG - Intronic
1049661811 8:143822961-143822983 CACAGGAGGCAGGAAGGGACAGG + Intronic
1050014589 9:1220341-1220363 AAAAAAAAGCAGCCAGGGCCAGG - Intergenic
1050185143 9:2965442-2965464 TCCAGAAAGCAGCCAGGGACTGG + Intergenic
1050353325 9:4760890-4760912 CACAAAAGGGAGCCTGGGCACGG - Intergenic
1051050073 9:12922106-12922128 CACTTAAGGAAGCCAGGGACCGG - Intergenic
1052393106 9:27904407-27904429 CTCAAAAAGCAGGCAGGGAAGGG + Intergenic
1053150337 9:35739122-35739144 CACAGAAGGGAGGCAGGGAATGG + Intronic
1053564703 9:39236898-39236920 CAAAAAAGGCATCCTGGGAGAGG + Intronic
1053830484 9:42074799-42074821 CAAAAAAGGCATCCTGGGAGAGG + Intronic
1054132449 9:61382136-61382158 CAAAAAAGGCATCCTGGGAGAGG - Intergenic
1054600075 9:67112656-67112678 CAAAAAAGGCATCCTGGGAGAGG - Intergenic
1057426621 9:94955766-94955788 TGGAAAGGGCAGCCAGGGACAGG + Intronic
1057534705 9:95888823-95888845 CACAAAAGACAGTTAGGGAAGGG - Intronic
1059405018 9:114094078-114094100 GACATAAGGGAGCCAGGGGCAGG + Intronic
1060810922 9:126611197-126611219 CAGAGAAGGCAGCCAGGCTCTGG + Intergenic
1061572011 9:131483701-131483723 CAGAAAAGGCAGCCTGAGTCTGG - Intronic
1062203577 9:135322084-135322106 TACAAAAAGAAGACAGGGACAGG + Intergenic
1192167176 X:68833367-68833389 CACATAGGGCAGCCAGGCAAGGG + Intronic
1193448933 X:81642835-81642857 CTCAAAAGTCATCCTGGGACAGG + Intergenic
1196653104 X:118188703-118188725 TAAAACAGGCAGCCAGGGAGTGG - Intergenic
1197237461 X:124083908-124083930 CACAAAAAGCAGCCAGGCAGTGG - Intronic
1199217837 X:145281806-145281828 AACAAAAAGTAGCCAGGGAGTGG - Intergenic
1199591179 X:149469686-149469708 CCCAAAAGGGAGCCAGAGATTGG + Intergenic
1199977310 X:152902007-152902029 CTCAAAAGGGAGCTAGGAACTGG + Intergenic
1201900298 Y:19041558-19041580 CACAAGAGCAAGCCAGAGACCGG + Intergenic
1202268210 Y:23043248-23043270 TACTAAAGGAAGCCAGGTACAGG - Intergenic
1202421202 Y:24676992-24677014 TACTAAAGGAAGCCAGGTACAGG - Intergenic
1202449584 Y:24993090-24993112 TACTAAAGGAAGCCAGGTACAGG + Intergenic