ID: 1076768301

View in Genome Browser
Species Human (GRCh38)
Location 10:132649681-132649703
Sequence TTGAATAAGCATGCGTGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076768295_1076768301 -6 Left 1076768295 10:132649664-132649686 CCTCTCTCCCCACTGGCTTGAAT 0: 1
1: 0
2: 1
3: 33
4: 363
Right 1076768301 10:132649681-132649703 TTGAATAAGCATGCGTGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076768301 Original CRISPR TTGAATAAGCATGCGTGGGT AGG Intronic
No off target data available for this crispr