ID: 1076771659

View in Genome Browser
Species Human (GRCh38)
Location 10:132669407-132669429
Sequence AAAGCCTTGAGGTTAAGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 212}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076771659_1076771668 23 Left 1076771659 10:132669407-132669429 CCTATTCTTAACCTCAAGGCTTT 0: 1
1: 0
2: 1
3: 10
4: 212
Right 1076771668 10:132669453-132669475 CCACAGAACGAGAGGGAGCTGGG No data
1076771659_1076771669 24 Left 1076771659 10:132669407-132669429 CCTATTCTTAACCTCAAGGCTTT 0: 1
1: 0
2: 1
3: 10
4: 212
Right 1076771669 10:132669454-132669476 CACAGAACGAGAGGGAGCTGGGG No data
1076771659_1076771661 -2 Left 1076771659 10:132669407-132669429 CCTATTCTTAACCTCAAGGCTTT 0: 1
1: 0
2: 1
3: 10
4: 212
Right 1076771661 10:132669428-132669450 TTCTATGTAGCACGTCCTCACGG No data
1076771659_1076771664 15 Left 1076771659 10:132669407-132669429 CCTATTCTTAACCTCAAGGCTTT 0: 1
1: 0
2: 1
3: 10
4: 212
Right 1076771664 10:132669445-132669467 TCACGGGACCACAGAACGAGAGG No data
1076771659_1076771666 22 Left 1076771659 10:132669407-132669429 CCTATTCTTAACCTCAAGGCTTT 0: 1
1: 0
2: 1
3: 10
4: 212
Right 1076771666 10:132669452-132669474 ACCACAGAACGAGAGGGAGCTGG No data
1076771659_1076771671 30 Left 1076771659 10:132669407-132669429 CCTATTCTTAACCTCAAGGCTTT 0: 1
1: 0
2: 1
3: 10
4: 212
Right 1076771671 10:132669460-132669482 ACGAGAGGGAGCTGGGGGTGTGG No data
1076771659_1076771665 16 Left 1076771659 10:132669407-132669429 CCTATTCTTAACCTCAAGGCTTT 0: 1
1: 0
2: 1
3: 10
4: 212
Right 1076771665 10:132669446-132669468 CACGGGACCACAGAACGAGAGGG No data
1076771659_1076771662 -1 Left 1076771659 10:132669407-132669429 CCTATTCTTAACCTCAAGGCTTT 0: 1
1: 0
2: 1
3: 10
4: 212
Right 1076771662 10:132669429-132669451 TCTATGTAGCACGTCCTCACGGG No data
1076771659_1076771670 25 Left 1076771659 10:132669407-132669429 CCTATTCTTAACCTCAAGGCTTT 0: 1
1: 0
2: 1
3: 10
4: 212
Right 1076771670 10:132669455-132669477 ACAGAACGAGAGGGAGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076771659 Original CRISPR AAAGCCTTGAGGTTAAGAAT AGG (reversed) Intronic
908428539 1:64032744-64032766 AAATCCTTGAGGCTTACAATAGG - Intronic
910686801 1:89925891-89925913 AAAGCATGGATGTTAAGTATAGG - Intronic
911455225 1:98113868-98113890 ACTGCCTTGAGGTCAAGACTAGG + Intergenic
916382495 1:164227921-164227943 AAAGACTTGAAATTCAGAATGGG + Intergenic
916670360 1:167012786-167012808 AAAGCCTTGAGGTAAAGGCTTGG + Intronic
916731581 1:167571680-167571702 AAAGCCTGGAGGTTTGGAACGGG - Intergenic
916908209 1:169312930-169312952 TTAGCCTTGATGTTTAGAATAGG - Intronic
917233605 1:172865225-172865247 ATAACATTGAGGTAAAGAATTGG - Intergenic
918622480 1:186621420-186621442 AAAGTCAGGAGATTAAGAATAGG - Intergenic
918964385 1:191322612-191322634 AAATCCATGAGGATAAGACTGGG - Intergenic
919078340 1:192839337-192839359 AAATGCTTGAGGTTAAGATATGG + Intergenic
919541829 1:198856876-198856898 AAAGCCATAAAGTTAAGAATGGG + Intergenic
919665890 1:200291512-200291534 AAAGCCCTCAGCTCAAGAATTGG + Intergenic
923159652 1:231305250-231305272 AAAACCATAAGGTTAAGACTGGG - Intergenic
1064327134 10:14361982-14362004 AAGGTCTTGTGGTTAAGACTTGG - Intronic
1068709215 10:60114896-60114918 AAAGCCTGTAAGTTAAAAATGGG - Intronic
1068984601 10:63095578-63095600 TAAGCCTTCTGGTTAACAATGGG + Intergenic
1070767350 10:79064391-79064413 TGGGCCTTGAGGTTGAGAATAGG - Intergenic
1071003991 10:80861102-80861124 AAATCAGTGAGGTTAAGAAATGG + Intergenic
1072769749 10:98127825-98127847 CAAGCCTTGAGATCAAGAAGTGG + Intergenic
1074015557 10:109530400-109530422 AAGGCCTGGAAGTTCAGAATGGG + Intergenic
1075758479 10:124836147-124836169 ACAGCCATGAGGTTAATACTTGG + Exonic
1076771659 10:132669407-132669429 AAAGCCTTGAGGTTAAGAATAGG - Intronic
1077187052 11:1240077-1240099 ACAGCCTTGAGGGTAAGGAAGGG + Exonic
1077681577 11:4246579-4246601 AAAACCTGGAAGTTAGGAATAGG - Intergenic
1077689319 11:4325903-4325925 AAAACCTGGAAGTTAGGAATAGG + Intergenic
1078975379 11:16468800-16468822 AAAGCCCTGACTTTAAGAGTAGG + Intronic
1080039016 11:27739328-27739350 AAAGTCTTGAGGGAAAAAATGGG + Intergenic
1080773182 11:35361583-35361605 CAATCCTTTAGGTTAAGAAGAGG + Intronic
1085381338 11:76121913-76121935 AAAGCCTAGTGGGTAAGACTCGG - Intronic
1087685853 11:101264403-101264425 AAAGCAATGTGGTTAAGAAAGGG - Intergenic
1087902071 11:103651979-103652001 AAAGCCATGAGATTAGGATTAGG + Intergenic
1088340535 11:108760784-108760806 AAAGCCTAGAGTTTAGAAATGGG + Intronic
1088939825 11:114441885-114441907 AAAGCCCTGAGTTTTAGATTTGG + Intronic
1090052989 11:123396680-123396702 AAATCCCTGAGGTCAAGAATAGG - Intergenic
1093485608 12:19648906-19648928 AAAGCGTTCAGGTTAAATATTGG - Intronic
1093846509 12:23978389-23978411 AAAACTTTGGGGTTAATAATAGG + Intergenic
1095112400 12:38312454-38312476 GAAGCCTGGAGATGAAGAATTGG + Intergenic
1095276078 12:40283950-40283972 AAAGCGTTGACGATAAGCATTGG + Exonic
1095619115 12:44228009-44228031 AAAACCTGGAGGTTAAGGGTAGG + Intronic
1095851257 12:46809560-46809582 AAACTCTTGTGGTGAAGAATGGG - Intronic
1097065116 12:56315304-56315326 AAAGCCTTGGGGTGAGGATTGGG - Intronic
1097359149 12:58638845-58638867 AATGCTTTGAGTTTAATAATTGG - Intronic
1098208331 12:68136115-68136137 AGAGCTTTGAGGTCCAGAATAGG + Intergenic
1098214490 12:68200892-68200914 AAAGCCTTGTGGGAATGAATTGG + Intergenic
1100776590 12:97981485-97981507 AAAGCCTTTCGTTTAAGAACTGG + Intergenic
1101513142 12:105410546-105410568 AATGACTTGAGGCTAAGAAATGG - Intergenic
1101556512 12:105814887-105814909 AAAGAATTAAGGTGAAGAATGGG - Intergenic
1103051371 12:117782839-117782861 AAAGGCTGTAGGGTAAGAATGGG + Intronic
1103292778 12:119860748-119860770 AAAGCCTTTAGATAAAGAAATGG - Intronic
1104228069 12:126856504-126856526 AAAGTAATGAGGTTAAGAAGTGG + Intergenic
1105924485 13:24995329-24995351 AAAGCCTTCAAGTTAAGCCTAGG + Intergenic
1108045252 13:46377785-46377807 AAAGCATTGAGAGTTAGAATAGG + Intronic
1108699080 13:52928433-52928455 AAGGCCTTGAGGGCAAGGATTGG + Intergenic
1108893012 13:55285521-55285543 AGAGCTTTGAGATTCAGAATTGG - Intergenic
1111238979 13:85450074-85450096 AGAGCCATAAGGTTAAGAACTGG - Intergenic
1112495678 13:99902168-99902190 AAAGGAATAAGGTTAAGAATAGG - Intergenic
1115440343 14:33427276-33427298 ACAGGCTTGAGGTTCAGTATGGG - Intronic
1116044086 14:39721591-39721613 CAAGCCTTGTGGTTTAGAAATGG + Intergenic
1117951330 14:61084956-61084978 AATGCCTTGTGGTGTAGAATTGG - Intergenic
1126557096 15:50000804-50000826 AAAGCTTTGAGGAAAAAAATAGG - Intronic
1129135501 15:73546410-73546432 AAAGCTTTGTGGTTTATAATAGG + Intronic
1129636055 15:77319281-77319303 AAAGCCTTGAGTTTTATAAGTGG - Intronic
1130618030 15:85431574-85431596 AAAGCTTTGAGGTGAAGGAGTGG + Intronic
1135396481 16:22135685-22135707 AAGGCCCTGAGCTTAGGAATGGG - Intronic
1136251228 16:29006769-29006791 ATAGCATTTAGGTTAAGGATTGG + Intergenic
1138004130 16:53314878-53314900 AATTCCTTGAGGTTGAGTATAGG - Exonic
1138895666 16:61200917-61200939 AGAGATTTGAGGATAAGAATAGG + Intergenic
1140636038 16:76914960-76914982 AAAGACTTTATGTTAAGCATTGG + Intergenic
1141954568 16:87361876-87361898 GGAGCCTTGAGGTTCAGAAGTGG - Intronic
1143109911 17:4547339-4547361 AAAGGCCTGACGTCAAGAATTGG + Intronic
1143911048 17:10249377-10249399 AAAGCTTTGGGGTCAGGAATAGG + Intergenic
1146905231 17:36613721-36613743 ACATCCTTGAAGTTCAGAATTGG - Intergenic
1150495120 17:65601888-65601910 AAAGCCTTAAGGTGGGGAATAGG + Intronic
1151104664 17:71598624-71598646 CAAGCCTTCAGGTAAAGATTGGG + Intergenic
1155204014 18:23541865-23541887 AAAGGCATGAGGGTAAGACTTGG + Intronic
1158345743 18:56515011-56515033 AAAGCATAGAGGAGAAGAATGGG + Intergenic
1159029495 18:63216572-63216594 AAAGACTTGATGGTAAAAATAGG - Intronic
1159625813 18:70692673-70692695 AAAGCCTAGAGGATAAAATTGGG + Intergenic
1159678812 18:71321079-71321101 GGAGCCTTGAGGTTAAGCACAGG + Intergenic
1161088230 19:2344758-2344780 AAAGCCCTGAGGGTCAGAGTCGG + Intronic
1161108179 19:2454956-2454978 AAAGTGTTGAGGTTCTGAATGGG - Intronic
1164090772 19:21949831-21949853 AAGGCCACGAGGTTAACAATGGG + Intronic
1164109911 19:22146526-22146548 AATGCCATGAAGTTAACAATGGG + Intergenic
1164194884 19:22947656-22947678 AAGGCCATGAGGTTAACAATGGG + Intergenic
1167274911 19:48531515-48531537 AAAGAATTGAGTTTAAGACTGGG + Intergenic
927981114 2:27375754-27375776 CAAGCCTTGAGCTTAGGTATGGG + Intronic
930307915 2:49699694-49699716 AAAGCCAAGTGATTAAGAATTGG - Intergenic
930485395 2:52006331-52006353 AAAGCCTTGGTTTTAAGACTCGG + Intergenic
933528117 2:83469651-83469673 AAAGCATTTAGCTTTAGAATTGG + Intergenic
933619762 2:84524964-84524986 AAAGGCTTGAGATTAAGTAAAGG - Intronic
934786890 2:97016493-97016515 AAAGCTTTGATGTTAAAGATAGG - Intronic
935711803 2:105905666-105905688 ATTGCCTGGAGGTTGAGAATAGG - Intergenic
936373684 2:111923333-111923355 AAAGCCCTGACTTTAAGAAGCGG + Intronic
937021891 2:118664934-118664956 AAAGCCTTGGAGTTAGGAAGAGG + Intergenic
937089592 2:119197026-119197048 AGAGCCCTGAGGTGAAGAACTGG + Intergenic
937740319 2:125344567-125344589 AAAGCCTTTAGGTAAAGCGTAGG + Intergenic
938471049 2:131561937-131561959 AAACACTTGATGTTAAAAATAGG - Intergenic
938734056 2:134170283-134170305 ACAGCCTTGAGGTGAAGGAATGG - Intronic
939238779 2:139532586-139532608 AAAGTATTGATGTTAAGTATAGG + Intergenic
940000646 2:148963729-148963751 AAAGCCTTTTGGTAAAGGATTGG + Intronic
940686065 2:156852499-156852521 AAAGCCCTGAGGTTGTGAATTGG - Intergenic
941135608 2:161714414-161714436 AAAGTCTTAAGGTGAAGAAAGGG - Intronic
942386129 2:175445051-175445073 ATAACCTAGAGGTTAAGATTCGG + Intergenic
942525671 2:176850259-176850281 GCAGCCTTGAGGATAGGAATGGG - Intergenic
942891546 2:180995475-180995497 TAAGGCTTCAGGTCAAGAATAGG + Intronic
945881226 2:215327279-215327301 AAAGCCTTGGGGTAAAGGCTTGG + Intronic
946051625 2:216867570-216867592 CAAGGCTTGAGGGTAAGAGTAGG - Intergenic
946213010 2:218162556-218162578 GAAGGCTTGAGGTTGGGAATAGG - Intergenic
947062360 2:226181163-226181185 AAAGCCAAGAGGTAAAGAAGTGG + Intergenic
948215597 2:236227808-236227830 TATGCATGGAGGTTAAGAATGGG - Intronic
949023764 2:241755409-241755431 AAGGCCCTGAGGATGAGAATGGG - Intronic
1170137916 20:13095573-13095595 AAAGCCTTAAGCTGGAGAATAGG - Intronic
1171064284 20:21998181-21998203 AAAGCCTTCCCCTTAAGAATTGG + Intergenic
1172407216 20:34698779-34698801 GATGCCTTGAGGTTGAGACTGGG + Intronic
1172420772 20:34815549-34815571 AAAACCAAGAGGTAAAGAATAGG + Intronic
1173828650 20:46063798-46063820 AAAGCCTTGAGATTGAGAGTGGG + Intronic
1173995915 20:47338581-47338603 AAAGTCCTGGGGTTAAGATTGGG - Intronic
1176152194 20:63597496-63597518 AGTGCCTTCAGGTAAAGAATTGG + Intronic
1177538212 21:22457444-22457466 CAAGCCTTGAGGCTCAGACTTGG - Intergenic
1180725965 22:17946830-17946852 AAAGACCAGAGGTTAAAAATAGG - Intronic
1181875592 22:25938058-25938080 AAAGCATTCTGGTTAAGAAATGG - Intronic
1183979235 22:41530058-41530080 AAAGCCCTGAGATTAAGGGTAGG - Intronic
949200351 3:1370479-1370501 GAAGCCTTGGAATTAAGAATGGG + Intronic
949858199 3:8481485-8481507 TAAGCCTTGAGGTTGAGATCTGG - Intergenic
951462988 3:22970821-22970843 AAAGACTTGATGGTAGGAATTGG + Intergenic
952244103 3:31566560-31566582 AAGGCCTTGAGGTGGAGAAATGG - Intronic
954459763 3:50619626-50619648 AAAGCCTTGGTATTAAGAAGTGG - Intronic
954625254 3:52019032-52019054 ACAGCCTTGAGGGTAGAAATCGG - Intergenic
955085784 3:55701330-55701352 AAAGCCTAGAGATTGAGAATTGG - Intronic
955095393 3:55792208-55792230 CAATCTTTGAGGTTAAGACTGGG + Intronic
955112488 3:55962782-55962804 ATAGCATAGAGGTTAAGAGTTGG - Intronic
956932169 3:74056156-74056178 AAAGCCTTAATGTGAAGAAATGG + Intergenic
957613137 3:82494779-82494801 AAATACTAGAGGTTAAGTATTGG + Intergenic
958051878 3:88358409-88358431 AAAGCCTTTAGTTTAAGATCCGG - Intergenic
958702365 3:97609692-97609714 AAAGCCTTGTGGGTTAGAAAGGG - Intronic
959332586 3:105024365-105024387 AAAGCCTTGAGTTGTAGAGTTGG - Intergenic
960290160 3:115874360-115874382 AAAACCTAGGGGTTGAGAATAGG - Intronic
960740533 3:120828256-120828278 ACAGTCTTGAGGATTAGAATAGG - Intergenic
961562929 3:127743243-127743265 AAAGCATTGAGGTTAAAGACTGG - Intronic
962840213 3:139226018-139226040 AAGGCCCTGAGGATAAGAACTGG + Intronic
964754781 3:160083316-160083338 GAAGCCATGAGGTTAAGACCAGG - Intergenic
964754801 3:160083439-160083461 AATGCCGTGAGGTTAAGGCTAGG - Intergenic
964754820 3:160083554-160083576 TAAACCATGAGGTTAAGACTGGG - Intergenic
964755321 3:160086713-160086735 AAAACCATGAGGTTAAGGGTAGG - Intergenic
964755829 3:160089988-160090010 AATGCCATGAGGTTAAGCTTAGG - Intergenic
964756220 3:160092684-160092706 AAAACCATGAGGTTAAGACCAGG - Intergenic
964756774 3:160096034-160096056 AAAACCATGAGGTTAAGACCAGG - Intergenic
968972404 4:3802891-3802913 AAAGCTTTGAGGATAAGGACTGG - Intergenic
970010970 4:11458941-11458963 AATTCCTTCAGGCTAAGAATTGG - Intergenic
972213801 4:36871783-36871805 AAACCAGTGAGGTTCAGAATGGG + Intergenic
972419567 4:38873907-38873929 AGAGCCGTGAGGTGAAGGATGGG + Intronic
973154382 4:46931689-46931711 GAACTGTTGAGGTTAAGAATTGG - Intronic
975265392 4:72359321-72359343 AATACCTTGAGGTCCAGAATAGG - Intronic
975270818 4:72430768-72430790 AAAGCTGTGTGGTTAAGAAAGGG + Intronic
976319419 4:83696009-83696031 AAGACCTTGAGATTAAGGATTGG - Intergenic
976782637 4:88778022-88778044 AAGGCCTTGAGGCAGAGAATGGG - Intronic
977350089 4:95873164-95873186 AAAGCCCTGTGGTTAAGAGCAGG + Intergenic
980239416 4:130154067-130154089 AAAGGTTTTAGGCTAAGAATGGG - Intergenic
983428426 4:167617472-167617494 AAAGCCTTTCCTTTAAGAATTGG - Intergenic
983638587 4:169923693-169923715 AAAGTTTTGATGTTAAGAAAGGG - Intergenic
984233316 4:177126482-177126504 AAAGTCTGGAGGTTGAGATTAGG - Intergenic
984429591 4:179631519-179631541 AAAGCCTTGGGGGAAATAATGGG - Intergenic
985042033 4:185900334-185900356 ACAGCCTTTAGGTTAACAACGGG + Intronic
985968910 5:3360037-3360059 AATGCTTTGAGGTTAATATTGGG - Intergenic
987819597 5:22945848-22945870 TAAGACCAGAGGTTAAGAATAGG - Intergenic
988156919 5:27465335-27465357 CAAGCATTGTGGTGAAGAATTGG + Intergenic
991017979 5:61951560-61951582 AATGCATTGAGGTGAAGAAAGGG - Intergenic
991432312 5:66561027-66561049 ATAGTCTTAAGGTAAAGAATTGG + Intergenic
992060402 5:73039209-73039231 AAAGCCTTCAGGCTATGAAGAGG - Intronic
992141848 5:73805322-73805344 AAAACCTTGAGGTTGGGGATGGG + Intronic
995819278 5:116209075-116209097 AAAGGCTTTAGGGTAAGACTTGG - Intronic
998242732 5:140463629-140463651 AAACCCTTGTGGTTCTGAATTGG - Intronic
998788307 5:145737161-145737183 AACTCCTTGAGGGCAAGAATTGG - Intronic
1001261960 5:170237772-170237794 AAAGACTTGAGGTTAAAACAAGG + Intronic
1002109234 5:176897031-176897053 AAAGCCTGGAGGTTGAGATGGGG - Intronic
1002878224 6:1229812-1229834 AGAGCCTTGAGGGAAAGAGTGGG + Intergenic
1003932246 6:10935953-10935975 AAAGCCTATAGGTTAAGGGTTGG - Intronic
1004763437 6:18696992-18697014 GAAGACTAGAGGTTAAGCATTGG - Intergenic
1005782724 6:29209844-29209866 ATGGCCTTCAGGGTAAGAATGGG + Intergenic
1008459492 6:51751728-51751750 AACTCCTTGAGGTGAAAAATAGG - Intronic
1009770089 6:68134641-68134663 ACAGCATTCAAGTTAAGAATTGG - Intergenic
1010306575 6:74330787-74330809 AAAGCCTTTTCGCTAAGAATTGG - Intergenic
1010451333 6:76006770-76006792 AAAGCTTTGAGTTAATGAATAGG - Intronic
1011830329 6:91364131-91364153 ATAGCATTTAGGTTAAGGATTGG + Intergenic
1014189598 6:118478492-118478514 AAAACCTTGATGGTCAGAATGGG + Intronic
1014882197 6:126736950-126736972 AAAACATTTAGGTTAAGAAAGGG - Intergenic
1018159165 6:161020979-161021001 AAAGCTTTAAAGTTAAAAATAGG + Intronic
1018552118 6:165009339-165009361 ATAGCCTGGAGGTGAATAATAGG + Intergenic
1020521500 7:9193785-9193807 TAAGCCTAGAGGTGAAGAATGGG + Intergenic
1021723771 7:23531198-23531220 AAAGCCTTGAGGTTGAAGGTGGG - Intronic
1022768320 7:33440591-33440613 AAAGGTTTGAGGTCAAGAAAGGG + Intronic
1023044544 7:36199571-36199593 AGAGCCTTGAGGTCAACAGTGGG + Intronic
1024475462 7:49803893-49803915 AAACTCTTGAGGTAAATAATTGG + Intronic
1028102492 7:86838491-86838513 AAAGACTTCATGATAAGAATTGG - Intronic
1028250271 7:88531904-88531926 AAAGGATTGAGATTAAGATTAGG + Intergenic
1028459922 7:91080512-91080534 GGAGCCTTGAGGTTAAGAACTGG - Intronic
1030574176 7:111265480-111265502 CAATCCTTGATGATAAGAATTGG - Intronic
1030974653 7:116106600-116106622 AAAGACTTGAGGTCAGGCATTGG - Intronic
1031609167 7:123804990-123805012 AAAGGCTAGAGGTTAAGGAAGGG - Intergenic
1032072045 7:128814004-128814026 AAATCCCTGAGGTTCAGAATTGG + Intronic
1039083657 8:33758711-33758733 AAAGCCTTGAAGAAAAGCATAGG - Intergenic
1039244212 8:35590596-35590618 AAAGCCTTGATGATTAAAATGGG - Intronic
1051651195 9:19327345-19327367 AAACCTTTGAGATTGAGAATAGG + Intronic
1052561293 9:30087794-30087816 ATAGCATTTAGGTTAAGGATTGG - Intergenic
1055727108 9:79242315-79242337 AAAGTGTTGAGGGTAAGAAACGG + Intergenic
1057418860 9:94891757-94891779 AAACCCATAAGGTGAAGAATAGG + Intronic
1057632168 9:96728507-96728529 AAAGCAATGAGGTTCAGACTGGG - Intergenic
1058076341 9:100655851-100655873 AAAGCCCTGTGATTAAGCATGGG + Intergenic
1059770129 9:117415968-117415990 AAAGACTGCAGGTGAAGAATTGG - Intergenic
1059806526 9:117807070-117807092 AAGAACTTCAGGTTAAGAATTGG - Intergenic
1185970750 X:4659941-4659963 AAAGGCTGGATGTTAAGAGTAGG + Intergenic
1186484546 X:9923881-9923903 AATCACTTGTGGTTAAGAATGGG - Intronic
1186498772 X:10033651-10033673 AAAGCCTTGAGGTAAAGCTGAGG - Intronic
1188414764 X:29918997-29919019 AAAGTCTTGACATTTAGAATGGG - Intronic
1193894154 X:87090705-87090727 AAAGCCTTTACTTTAAGATTAGG + Intergenic
1195476653 X:105294197-105294219 AAAACCTTGAGGTTAATAATCGG + Intronic
1196249182 X:113438720-113438742 TGATGCTTGAGGTTAAGAATGGG + Intergenic
1196552377 X:117044648-117044670 AAAGCCTTGAAGTAAGAAATGGG - Intergenic
1197127592 X:122965771-122965793 CAAGCCTTCAGGAGAAGAATTGG - Intergenic
1197270615 X:124420831-124420853 AAAGACTTGATTTTAACAATTGG + Intronic
1198019401 X:132643570-132643592 AAAGCCCAGAGGTGAAGGATAGG + Intronic
1198761200 X:140034271-140034293 AAAACATTGAGGTTGAAAATAGG + Intergenic
1201723722 Y:17132287-17132309 AAAGCCCTGTTGTAAAGAATAGG + Intergenic