ID: 1076771660

View in Genome Browser
Species Human (GRCh38)
Location 10:132669418-132669440
Sequence GTGCTACATAGAAAGCCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 102}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076771660_1076771670 14 Left 1076771660 10:132669418-132669440 CCTCAAGGCTTTCTATGTAGCAC 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1076771670 10:132669455-132669477 ACAGAACGAGAGGGAGCTGGGGG No data
1076771660_1076771665 5 Left 1076771660 10:132669418-132669440 CCTCAAGGCTTTCTATGTAGCAC 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1076771665 10:132669446-132669468 CACGGGACCACAGAACGAGAGGG No data
1076771660_1076771673 25 Left 1076771660 10:132669418-132669440 CCTCAAGGCTTTCTATGTAGCAC 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1076771673 10:132669466-132669488 GGGAGCTGGGGGTGTGGTGGAGG No data
1076771660_1076771666 11 Left 1076771660 10:132669418-132669440 CCTCAAGGCTTTCTATGTAGCAC 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1076771666 10:132669452-132669474 ACCACAGAACGAGAGGGAGCTGG No data
1076771660_1076771668 12 Left 1076771660 10:132669418-132669440 CCTCAAGGCTTTCTATGTAGCAC 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1076771668 10:132669453-132669475 CCACAGAACGAGAGGGAGCTGGG No data
1076771660_1076771664 4 Left 1076771660 10:132669418-132669440 CCTCAAGGCTTTCTATGTAGCAC 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1076771664 10:132669445-132669467 TCACGGGACCACAGAACGAGAGG No data
1076771660_1076771671 19 Left 1076771660 10:132669418-132669440 CCTCAAGGCTTTCTATGTAGCAC 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1076771671 10:132669460-132669482 ACGAGAGGGAGCTGGGGGTGTGG No data
1076771660_1076771674 30 Left 1076771660 10:132669418-132669440 CCTCAAGGCTTTCTATGTAGCAC 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1076771674 10:132669471-132669493 CTGGGGGTGTGGTGGAGGAGTGG No data
1076771660_1076771669 13 Left 1076771660 10:132669418-132669440 CCTCAAGGCTTTCTATGTAGCAC 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1076771669 10:132669454-132669476 CACAGAACGAGAGGGAGCTGGGG No data
1076771660_1076771672 22 Left 1076771660 10:132669418-132669440 CCTCAAGGCTTTCTATGTAGCAC 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1076771672 10:132669463-132669485 AGAGGGAGCTGGGGGTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076771660 Original CRISPR GTGCTACATAGAAAGCCTTG AGG (reversed) Intronic
902237098 1:15064448-15064470 GTGCTTCATACAAAGACATGTGG - Intronic
909049937 1:70754454-70754476 GAGCAAGATGGAAAGCCTTGGGG + Intergenic
910045914 1:82916036-82916058 TTGCTACATATCAAACCTTGGGG - Intergenic
911697430 1:100906706-100906728 ATGCTATATAGATAGCTTTGAGG - Intronic
913339965 1:117748762-117748784 TTGCTACACAGAAAGACCTGAGG - Intergenic
915629325 1:157139024-157139046 GTGCTTCAGAGAAAGCTTTGCGG - Intergenic
920774320 1:208921439-208921461 GTGACACATGGAGAGCCTTGTGG - Intergenic
920821779 1:209388229-209388251 GAGCTACACAGAACGCCTTAGGG - Intergenic
922361737 1:224828826-224828848 GGGCCACAGAGAAAGCCTTCAGG + Intergenic
923403811 1:233641135-233641157 GTCCTACATAGAAAGTCTTCCGG - Intronic
923780328 1:237016770-237016792 GGGCTTCAGAGAAAGCCTAGCGG - Intergenic
924792303 1:247263099-247263121 ATGATATATAGAAAGCCTAGTGG - Intergenic
1064246951 10:13676028-13676050 GTGCTCGATAGGAAACCTTGTGG + Intronic
1070648217 10:78216094-78216116 GCGCTACATAAAAAGCCCAGTGG + Intergenic
1071498493 10:86187395-86187417 ATGCTACCTAGAAAGGCTGGAGG + Intronic
1072911310 10:99504218-99504240 ATACTACATAGAAAGTCTTCCGG + Intergenic
1073517775 10:104092976-104092998 GTGCTACAGATATATCCTTGAGG - Intergenic
1073744629 10:106452581-106452603 GGGCTAATGAGAAAGCCTTGAGG - Intergenic
1076771660 10:132669418-132669440 GTGCTACATAGAAAGCCTTGAGG - Intronic
1079774634 11:24509141-24509163 TTCCTACATGGAAAGTCTTGAGG - Intronic
1079915860 11:26367642-26367664 TTTCTACATAGAAATACTTGAGG + Intronic
1082137706 11:48568544-48568566 GTGCTAAATATATATCCTTGGGG + Intergenic
1082986281 11:59173103-59173125 TTTCTACATAGAAAGACTTAGGG - Intronic
1083671004 11:64299907-64299929 CAGCGACACAGAAAGCCTTGGGG - Exonic
1084460862 11:69295868-69295890 GTGCCACACAGAGTGCCTTGTGG - Exonic
1085554478 11:77407555-77407577 GTGCTATATAGATATCATTGTGG - Intronic
1085556302 11:77425519-77425541 GTGCCACAGAGATAGCCGTGGGG - Intronic
1086835358 11:91614401-91614423 GTTCTATATAGTAAGCTTTGGGG - Intergenic
1088213326 11:107480637-107480659 GTGCTATATAGAATGATTTGGGG - Intergenic
1089695914 11:120216202-120216224 GAGCAACATGGGAAGCCTTGAGG + Intronic
1093259067 12:16912171-16912193 CTACTACAAAGAAAGCATTGGGG - Intergenic
1094083178 12:26560023-26560045 GTGCTAAAGAGAGAGCCATGGGG - Intronic
1094659396 12:32452257-32452279 GTGGTACATAGAAATTTTTGTGG + Intronic
1095332038 12:40977693-40977715 CTGGTACATAGAAAGCCATCAGG - Intronic
1098461015 12:70732989-70733011 GTGCTACAGACACCGCCTTGAGG + Intronic
1098889871 12:75998948-75998970 ATGCTACAGAGAAATCCTTATGG - Intergenic
1100894446 12:99164022-99164044 GTTCAACATAGTAAGCCATGAGG - Intronic
1101853256 12:108421334-108421356 GTGTATCATAGAAATCCTTGAGG + Intergenic
1102751362 12:115297465-115297487 GTGCTCATTAGAGAGCCTTGGGG - Intergenic
1102863802 12:116358638-116358660 GTGCTTCAGAGAAAGCAGTGAGG + Intergenic
1103082510 12:118036494-118036516 ATGCTCCATAGAAAGACCTGTGG + Exonic
1103172127 12:118830352-118830374 AAGCTACAGGGAAAGCCTTGAGG + Intergenic
1103383270 12:120511824-120511846 GTGCTACATGCAAAACATTGGGG + Intronic
1108698682 13:52925495-52925517 GGGCTACAAAGAAAGCCTCATGG - Intergenic
1108950835 13:56089486-56089508 GTGCTGCAAAAAAAACCTTGGGG + Intergenic
1109887537 13:68561578-68561600 AAGCTACACAGAAAGCCTGGTGG + Intergenic
1127898822 15:63326181-63326203 GAGCTACAGAGAACACCTTGAGG + Exonic
1135734748 16:24921693-24921715 GTGGTGCATAGGAAACCTTGAGG - Intronic
1137418373 16:48307776-48307798 GTGCTACAAAGGAATACTTGAGG + Intronic
1156960401 18:43021759-43021781 ATGCTGCATAGAAAGCATGGTGG - Intronic
928356150 2:30617158-30617180 GAGGTACATAGAAAACCTTTGGG - Intronic
931422078 2:62137431-62137453 GGGCTACATTGAAAACCTTCTGG - Intronic
939545222 2:143543699-143543721 GATCTACATTGAAAGACTTGTGG - Intronic
1172308145 20:33896437-33896459 GTGCTTTATAAAAAGGCTTGAGG + Intergenic
950180733 3:10911450-10911472 GTACCACATAGGAAGCCTAGAGG + Intronic
950243407 3:11392585-11392607 AAGCTACAGAGACAGCCTTGGGG - Intronic
953690609 3:45114914-45114936 TTACTACATAGTAAGCCATGTGG + Intronic
957014284 3:75044558-75044580 GTGCAAGATGGACAGCCTTGGGG + Intergenic
960213608 3:115001981-115002003 TAGCTATATAGTAAGCCTTGGGG - Intronic
960756275 3:121017395-121017417 ATGTTAAATAGAAATCCTTGGGG - Intronic
961175993 3:124835372-124835394 CTGCCACATAGAAAGCCAAGGGG + Intronic
961350891 3:126301196-126301218 CGGCTACACAGAAAGCCCTGAGG - Intergenic
964823146 3:160795860-160795882 GAGCTACAGAGAAAACCTGGGGG - Intronic
965511626 3:169574130-169574152 GGGCTACCTGAAAAGCCTTGGGG + Intronic
968012090 3:195289453-195289475 GTGCTATATAGATAGCATGGTGG + Intronic
972367158 4:38386896-38386918 TTGCTACACAGAAAGCCATGAGG + Intergenic
978306249 4:107331486-107331508 GGGCTACTTAGCATGCCTTGTGG - Intergenic
980681347 4:136166137-136166159 CTGCTACATAGAAAGGTATGTGG + Intergenic
981624692 4:146742306-146742328 GTGCCACAGAGAAATGCTTGTGG - Intronic
982488287 4:155996224-155996246 ATGCCACATAGAAAGCTTTCTGG + Intergenic
984536953 4:180988366-180988388 CTGCTAACTAGAAAGCCTCGGGG + Intergenic
988436061 5:31176991-31177013 GTGCTACAGAGAAATCCTGCTGG + Intergenic
988634092 5:32962914-32962936 TTGCTAGTTAGAAAGCATTGAGG - Intergenic
989162807 5:38407960-38407982 GTGCTACATTCAAAGGCTGGGGG + Intronic
989701309 5:44268562-44268584 GTGCCACACAGAAACCCTGGAGG + Intergenic
990161923 5:52950538-52950560 GTGCTGCAAAGAAAGTGTTGGGG + Intronic
991953374 5:71968538-71968560 TTCACACATAGAAAGCCTTGAGG - Intergenic
995741563 5:115361160-115361182 GTGCTACAGAGAAATCTTTCAGG - Intergenic
1005474116 6:26190604-26190626 GGGATACATAGAAAGTCTTCAGG + Intergenic
1007494285 6:42248888-42248910 GTCCAACATTCAAAGCCTTGGGG + Intronic
1009277357 6:61700212-61700234 GTGCTACATAGCACACTTTGGGG - Intronic
1012089982 6:94879656-94879678 CTACTACATAGAAGGCTTTGAGG + Intergenic
1014230544 6:118897277-118897299 TTGCTTCAGAAAAAGCCTTGAGG + Intronic
1015544955 6:134352315-134352337 TTGCTTCCAAGAAAGCCTTGTGG + Intergenic
1019569543 7:1704509-1704531 GTGATACACACAAAGCCATGTGG + Intronic
1027597281 7:80189475-80189497 ATGCTACACAGAAAGCACTGTGG - Intronic
1030798504 7:113819269-113819291 GTGATAAATAGCAAGCCTTCAGG - Intergenic
1031509683 7:122634432-122634454 ATGCTACATAGAAAATCTGGAGG - Intronic
1033941868 7:146664626-146664648 TTAGTACATAGAAAACCTTGTGG - Intronic
1035340304 7:158156645-158156667 CTGCTGCATAGAACGCCCTGGGG + Intronic
1038026060 8:23591897-23591919 GGGCTTCAGAGAAAGCCCTGAGG - Intergenic
1038028795 8:23618143-23618165 GTGCCACGTAGAAAAACTTGTGG + Intergenic
1038385764 8:27143220-27143242 GTGCTAAAAATAAAGCCTTTGGG + Intergenic
1038989480 8:32851945-32851967 TTCCTACAGAGAAAGCCTAGTGG + Intergenic
1045263932 8:100603129-100603151 GGGACACAGAGAAAGCCTTGGGG - Intronic
1045448811 8:102297998-102298020 CTGCTAAATAGAAAGCATTAAGG - Intronic
1045861400 8:106818398-106818420 CTGATAAATAGAAAGCCTTCTGG + Intergenic
1048922351 8:139242729-139242751 TTGCTACAAAGAAATACTTGAGG + Intergenic
1050677395 9:8071449-8071471 GAGCAACATAGGGAGCCTTGGGG + Intergenic
1050815992 9:9811902-9811924 ATGCTACATAGAAATCTTTCAGG + Intronic
1051516515 9:17936050-17936072 ATGCTAAATACAAAGCCTTGAGG - Intergenic
1056989288 9:91395124-91395146 GTGGTACATAGAAAGGCTGTCGG - Intergenic
1059787924 9:117606897-117606919 GTGCTACATAGTAATCCATGTGG - Intergenic
1061748320 9:132756276-132756298 GTTCTAGAGAGAAAGCTTTGAGG + Intronic
1187160454 X:16759804-16759826 GTGATACATAGAAAGCAGTTGGG + Intronic
1190958269 X:55219150-55219172 GGGATACATAAAAAGACTTGAGG + Intronic
1190963876 X:55279170-55279192 GGGATACATAAAAAGACTTGAGG + Intronic
1193815716 X:86102511-86102533 GTACTACATTGAGGGCCTTGCGG + Intergenic
1194397615 X:93404637-93404659 GTGCTACACAAAAAGCCTAGTGG - Intergenic