ID: 1076771668 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:132669453-132669475 |
| Sequence | CCACAGAACGAGAGGGAGCT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1076771659_1076771668 | 23 | Left | 1076771659 | 10:132669407-132669429 | CCTATTCTTAACCTCAAGGCTTT | 0: 1 1: 0 2: 1 3: 10 4: 212 |
||
| Right | 1076771668 | 10:132669453-132669475 | CCACAGAACGAGAGGGAGCTGGG | No data | ||||
| 1076771660_1076771668 | 12 | Left | 1076771660 | 10:132669418-132669440 | CCTCAAGGCTTTCTATGTAGCAC | 0: 1 1: 0 2: 0 3: 6 4: 102 |
||
| Right | 1076771668 | 10:132669453-132669475 | CCACAGAACGAGAGGGAGCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1076771668 | Original CRISPR | CCACAGAACGAGAGGGAGCT GGG | Intronic | ||
| No off target data available for this crispr | |||||