ID: 1076771668

View in Genome Browser
Species Human (GRCh38)
Location 10:132669453-132669475
Sequence CCACAGAACGAGAGGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076771659_1076771668 23 Left 1076771659 10:132669407-132669429 CCTATTCTTAACCTCAAGGCTTT 0: 1
1: 0
2: 1
3: 10
4: 212
Right 1076771668 10:132669453-132669475 CCACAGAACGAGAGGGAGCTGGG No data
1076771660_1076771668 12 Left 1076771660 10:132669418-132669440 CCTCAAGGCTTTCTATGTAGCAC 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1076771668 10:132669453-132669475 CCACAGAACGAGAGGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076771668 Original CRISPR CCACAGAACGAGAGGGAGCT GGG Intronic
No off target data available for this crispr