ID: 1076772631

View in Genome Browser
Species Human (GRCh38)
Location 10:132674841-132674863
Sequence AGTTACCTGCAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076772629_1076772631 4 Left 1076772629 10:132674814-132674836 CCAAGAGCTGTCTCTCAAAAGGA 0: 181
1: 197
2: 163
3: 130
4: 293
Right 1076772631 10:132674841-132674863 AGTTACCTGCAGAAGATGGCAGG No data
1076772624_1076772631 25 Left 1076772624 10:132674793-132674815 CCACCAAAGCCCAGTAACAGGCC 0: 144
1: 161
2: 86
3: 68
4: 218
Right 1076772631 10:132674841-132674863 AGTTACCTGCAGAAGATGGCAGG No data
1076772625_1076772631 22 Left 1076772625 10:132674796-132674818 CCAAAGCCCAGTAACAGGCCAAG 0: 169
1: 171
2: 103
3: 76
4: 232
Right 1076772631 10:132674841-132674863 AGTTACCTGCAGAAGATGGCAGG No data
1076772626_1076772631 16 Left 1076772626 10:132674802-132674824 CCCAGTAACAGGCCAAGAGCTGT 0: 174
1: 194
2: 145
3: 123
4: 215
Right 1076772631 10:132674841-132674863 AGTTACCTGCAGAAGATGGCAGG No data
1076772627_1076772631 15 Left 1076772627 10:132674803-132674825 CCAGTAACAGGCCAAGAGCTGTC 0: 162
1: 189
2: 129
3: 114
4: 178
Right 1076772631 10:132674841-132674863 AGTTACCTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076772631 Original CRISPR AGTTACCTGCAGAAGATGGC AGG Intronic
No off target data available for this crispr