ID: 1076772667

View in Genome Browser
Species Human (GRCh38)
Location 10:132675055-132675077
Sequence CTTTGGGTATGGAGGACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076772667_1076772671 -10 Left 1076772667 10:132675055-132675077 CCCTCAGTCCTCCATACCCAAAG 0: 1
1: 0
2: 1
3: 23
4: 154
Right 1076772671 10:132675068-132675090 ATACCCAAAGTCCAGAAAGTTGG No data
1076772667_1076772672 -9 Left 1076772667 10:132675055-132675077 CCCTCAGTCCTCCATACCCAAAG 0: 1
1: 0
2: 1
3: 23
4: 154
Right 1076772672 10:132675069-132675091 TACCCAAAGTCCAGAAAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076772667 Original CRISPR CTTTGGGTATGGAGGACTGA GGG (reversed) Intronic
901911125 1:12459112-12459134 CTGTGGATATGGAGAGCTGATGG - Intronic
904311562 1:29632733-29632755 CTTGGGGGCTGGGGGACTGAGGG - Intergenic
904870975 1:33617973-33617995 CTTAGGGTAAGGAAGACAGAGGG - Intronic
907341964 1:53741402-53741424 TTAAGGGAATGGAGGACTGAGGG + Intergenic
909374326 1:74922853-74922875 GTTGGGGGATGGGGGACTGAGGG + Intergenic
909570143 1:77100854-77100876 CTTTGTGTTTGTAGGACTGAGGG - Intronic
914678259 1:149920338-149920360 CCATGGATATGGAGGACTGATGG - Intergenic
916231373 1:162544468-162544490 ATTTGGGTATGGACAGCTGAGGG - Intergenic
916332609 1:163634250-163634272 GCTTGGGCATGGAGAACTGAGGG - Intergenic
916591958 1:166200086-166200108 CTTTGGGAAGGTAAGACTGAAGG + Intergenic
918222981 1:182452952-182452974 CTTTGGGTATGACTGAGTGATGG + Intronic
920746123 1:208630509-208630531 CCTGGAGTATGGAGGACTGAGGG + Intergenic
923146557 1:231202599-231202621 CTTTGGTTTTTGTGGACTGAGGG + Intronic
923280600 1:232439394-232439416 CTTTGGGTCTGGCGACCTGATGG - Exonic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924768217 1:247053806-247053828 CTATGGGCATGGATGACAGATGG - Intronic
1066415044 10:35213957-35213979 GCTTGGGTCTGGAGGACAGAGGG + Intergenic
1068100545 10:52547207-52547229 CCATGGGTATGGAGGGCTGACGG - Intergenic
1069762344 10:70820391-70820413 CTTTGGCAATGGGGGACTGGGGG + Intronic
1069818664 10:71214251-71214273 CTTTGGCTATGGAGGGGGGAAGG - Intronic
1070393447 10:75990833-75990855 CTGTGGGTGTGGAGGACTTCTGG + Intronic
1072638539 10:97193361-97193383 CTTGGACTTTGGAGGACTGAAGG - Intronic
1073056719 10:100707863-100707885 CTTTGGGGCTGGAAGACAGACGG - Intergenic
1073200101 10:101728304-101728326 CTGTGTTTATGGAGGACAGAGGG - Intergenic
1075589075 10:123678479-123678501 CTTGGGGTCAGGAGGCCTGAAGG + Intronic
1075950350 10:126472088-126472110 CTTTGGGGATAAAGGACTGTAGG - Intronic
1076772667 10:132675055-132675077 CTTTGGGTATGGAGGACTGAGGG - Intronic
1079265861 11:18932190-18932212 CAATGGATCTGGAGGACTGAGGG + Intergenic
1080845068 11:36019816-36019838 CTCTGTGGATGGAGGACTGGAGG + Intronic
1083140118 11:60714740-60714762 CTTTGGGTGTGGAGACCTGAGGG - Intronic
1084942456 11:72620299-72620321 CCTTGGGGAGGGAGCACTGAGGG - Intronic
1085844672 11:80051436-80051458 CTTTGGGTTTAGAGCACTGTGGG + Intergenic
1088686835 11:112290716-112290738 CTTTGTGTCTTGAGCACTGAGGG - Intergenic
1088750606 11:112839222-112839244 CTTTGAGTCTGGAGGAGTCAGGG - Intergenic
1089046188 11:115503812-115503834 CTTCGGGGATGGAGAACTGGGGG + Intronic
1091796911 12:3302756-3302778 CTGTGGATATGGAGGGCTGATGG + Intergenic
1093282486 12:17211431-17211453 CTGTGTGTATGCTGGACTGACGG + Intergenic
1096845226 12:54402966-54402988 GTTTGGGTAAGTAGGGCTGACGG - Exonic
1098465644 12:70783642-70783664 CTCTGGGTCTGCAGGACTGGCGG + Intronic
1104509256 12:129361057-129361079 CTTTGAATATGGAGGACTCAAGG - Intronic
1107298919 13:38945613-38945635 TTTTGGCTCTGGAGGACAGATGG - Intergenic
1107298935 13:38945706-38945728 TTTTGGCTCTGGAGGACAGATGG - Intergenic
1107568580 13:41632061-41632083 CCTTGGCTATGGAGGTCTGATGG - Intronic
1109170972 13:59096643-59096665 CTTTTGGATTGTAGGACTGAGGG + Intergenic
1109208410 13:59506954-59506976 CTCTGGGTTTGGGTGACTGAGGG - Intergenic
1111668124 13:91295647-91295669 CTGTGGGTATCCAGGCCTGAGGG - Intergenic
1113078830 13:106494843-106494865 CTGTGTGTATGGAGGTCTGTGGG - Intronic
1117035450 14:51723309-51723331 CTTTGGGAAGGGAGGTATGAGGG + Intronic
1118142962 14:63105045-63105067 CTTTTGGTGTGTAGAACTGAGGG - Intergenic
1118480831 14:66163658-66163680 CTTTGGGGATGGGGGGCTGGAGG - Intergenic
1120103248 14:80467691-80467713 CTTGGGTTATGGAGGGCTGGGGG - Intergenic
1121727573 14:96164447-96164469 CTTTGAGGATGGAGGAGGGAGGG + Intergenic
1122695891 14:103551908-103551930 CATGGGGTGAGGAGGACTGAGGG - Intergenic
1123113094 14:105882122-105882144 CTTTGGGGAGGGAGGAATGGAGG - Intergenic
1124058949 15:26269746-26269768 CCTTGGGTCTGCAGGACTGCAGG - Intergenic
1125323700 15:38514963-38514985 ATTTGGGTCTGGGGTACTGAGGG + Intronic
1127987239 15:64083329-64083351 CTTAGGGTTTGGAGGTCAGAAGG - Intronic
1128475369 15:67992794-67992816 ATTTGGGTGAGGAGGGCTGAAGG - Intergenic
1128636094 15:69303426-69303448 CTTTGAGGATGGAGGTCTGGTGG - Intronic
1129667074 15:77585231-77585253 CTTTGGGTGTACAGGACTGAAGG + Intergenic
1130154404 15:81337266-81337288 CTTGGGGTCTGGAGGACCCAGGG + Intronic
1132471217 16:104435-104457 CTATGGGTATGGAGAAATGAGGG + Intronic
1133748592 16:8706887-8706909 TTTTGGCTAAGGAGGAATGAGGG + Intronic
1138194658 16:55043434-55043456 CTTTGGGAAAGGAGGAGTGGGGG + Intergenic
1139138490 16:64233460-64233482 CTTTGGGTTTGGGGGGCTGAAGG + Intergenic
1141113075 16:81286357-81286379 CTTGGGGTATGGAGGGGTGGAGG - Intronic
1142006379 16:87691304-87691326 CTTTGGGAATGAAGGGCTGTGGG + Intronic
1144106542 17:11991496-11991518 CTTTAGCTATTGAGGATTGAGGG - Intronic
1144447817 17:15347386-15347408 CTATAGATATGGAGGGCTGATGG + Intergenic
1146307473 17:31741633-31741655 CTTTGGATATGGAGGGCTCTGGG + Intergenic
1146883445 17:36456125-36456147 CTTTGGGAAGGAAGGACAGAAGG + Intergenic
1146919709 17:36702549-36702571 CCTTGGGTATTCAGGACTGTGGG - Intergenic
1149138542 17:53400776-53400798 CTTTGGGTTTGGGGGAAGGAAGG - Intergenic
1150008651 17:61485753-61485775 CTTTGGGGAAGGAGCAATGAGGG - Intergenic
1151133495 17:71922832-71922854 CTATAGGTAAGAAGGACTGAGGG - Intergenic
1152012568 17:77727389-77727411 CCTTGGGTGAGGGGGACTGAGGG - Intergenic
1153437252 18:5080585-5080607 CTTAGGGTATGTGGGAGTGATGG - Intergenic
1155073833 18:22338365-22338387 GTTTGGGGATGGGGGACTGGAGG + Intergenic
1156554232 18:38049068-38049090 CCATGGGTATAGAGAACTGAGGG - Intergenic
1158774067 18:60555533-60555555 CTTTGGGTACTGAGGAGTGTGGG + Intergenic
1159368757 18:67504803-67504825 CTTTGGATCTGGAGGTCTCAGGG + Intergenic
1159799648 18:72882057-72882079 CTTAGGGTAGGGAGCACTTAAGG + Intergenic
1161083759 19:2324292-2324314 CTCCAGGGATGGAGGACTGAGGG + Intronic
1161186765 19:2926598-2926620 CTGTGGGTGTGGGGGACCGAGGG - Intergenic
1165495237 19:36148854-36148876 CTGTGGGTATGGACACCTGAGGG + Intronic
1168233539 19:55047877-55047899 CTGTGGGTTGGGAGGAGTGAGGG + Intronic
1168375614 19:55876866-55876888 CTGTGGATATGGAGGACTGACGG + Intronic
925474699 2:4200073-4200095 TTTTGGGTATGGAGGAAAGTGGG + Intergenic
929357891 2:41048700-41048722 CTTTGGGTATGTAGAAATAAAGG - Intergenic
929837672 2:45421779-45421801 CTTTTGTTCTGGAAGACTGAAGG + Intronic
930400217 2:50874976-50874998 TTTTGTGTATGGACAACTGATGG - Intronic
930793511 2:55360779-55360801 CTTTGGTTTTGTATGACTGATGG - Intronic
931551806 2:63454349-63454371 GTTTGGGGGTGGGGGACTGAGGG + Intronic
933960465 2:87405308-87405330 CTTTGTGTATTTAGTACTGACGG - Intergenic
934244541 2:90296010-90296032 CTTTGTGTATTTAGTACTGAGGG - Intergenic
934264310 2:91501462-91501484 CTTTGTGTATTTAGTACTGACGG + Intergenic
934720238 2:96569388-96569410 CTTTGGGTATAGACTTCTGATGG + Intergenic
936605296 2:113946142-113946164 CTTTGGGTATGTGGGATTGCTGG + Intronic
939352917 2:141063874-141063896 CTTTGGCCATGGAGAAATGAAGG + Intronic
942651732 2:178175934-178175956 CTTTGGCTGAGGAGAACTGAAGG - Intergenic
1171022879 20:21602698-21602720 CTGTGGGTAGGGAGGGCTGGAGG + Intergenic
1172864541 20:38085691-38085713 CTTTGGGTCTGGAGAGATGAAGG - Intronic
1173844811 20:46181462-46181484 CTTTGTGGCTGGAGGAATGAGGG + Intronic
1174110536 20:48195006-48195028 CAGTGGGTATGAAGGACGGAGGG - Intergenic
1181309128 22:21934211-21934233 CTTTGGGCATCCAGCACTGATGG + Exonic
1181384833 22:22536924-22536946 TTTTGGGTTTGGAGCACTCAAGG - Intergenic
1182095685 22:27623819-27623841 GTTTGGGCTTGGAGGGCTGAGGG - Intergenic
1183359582 22:37376527-37376549 CTTTGGGCATGGAGGAAAGGAGG - Intronic
1185253895 22:49821141-49821163 TGTTGGGTAGGCAGGACTGAAGG - Intronic
949196121 3:1310436-1310458 TCTTGGGTATGCAGGACTGATGG - Intronic
954361899 3:50126574-50126596 CCTTGGGGAGGGAGGACAGATGG - Intergenic
954527010 3:51280671-51280693 CTCTGGGTCTGGAGCACTGAGGG + Intronic
955056933 3:55463134-55463156 GTTTGGGAAGTGAGGACTGATGG - Intergenic
960519939 3:118643101-118643123 CTGTAGGCATGGAGGTCTGAGGG - Intergenic
964515857 3:157506779-157506801 ATTTGTGTCTGAAGGACTGAGGG - Intronic
964731566 3:159872315-159872337 CTTTGGTTCAGGAGGACTGAAGG + Intronic
968869517 4:3234565-3234587 CTGTGGGCATGGAGGACTCAGGG + Intronic
969533525 4:7742036-7742058 CTTTGGGTCTGGGGGACAGGTGG - Exonic
970143019 4:13003215-13003237 CTTTGGAGATGGAGGAATGAAGG - Intergenic
970508351 4:16755737-16755759 CTTTGGGTAAGGTGGACTCTAGG - Intronic
978345797 4:107767845-107767867 CTTTAAATAAGGAGGACTGATGG - Intergenic
980559400 4:134453358-134453380 CTTTGTGGATGCAGGACTGAAGG + Intergenic
981832181 4:149015050-149015072 ATTTGGGTATTGAGTTCTGATGG + Intergenic
985817029 5:2134726-2134748 CCTGGGGTATGGAAGCCTGACGG + Intergenic
986593989 5:9401542-9401564 CTTTGGCAATGGTGGAATGAGGG - Intronic
986923074 5:12711805-12711827 TTTTGGGTTTGGAGCACTAATGG - Intergenic
988895014 5:35663515-35663537 TTTTGGGTATGGAAGAATAAGGG - Intronic
992866568 5:80961834-80961856 CTTTGTGTTTGCAGGAATGAGGG - Intronic
992895187 5:81239486-81239508 CTTTGGGGAGGGAGGAGTGGGGG + Intronic
994183289 5:96791118-96791140 CCTTGAGCATGGAGGGCTGATGG + Intronic
995862555 5:116657075-116657097 GTTTCAGTGTGGAGGACTGATGG + Intergenic
1002769754 6:280985-281007 CCTTGGGGAAGGGGGACTGAAGG - Intergenic
1003130379 6:3390391-3390413 CTTTGGGGAGGGAGGAGAGAGGG - Intronic
1003572231 6:7263242-7263264 CCCTGGGTATAGAAGACTGAGGG - Intergenic
1006311471 6:33264204-33264226 CTGTGGGTAGGAGGGACTGAAGG - Intronic
1006811042 6:36820823-36820845 CTTCGGGTATTTAGGACTGCAGG - Intronic
1006812909 6:36831955-36831977 CTTTGGGTATGGAAGAATCCTGG - Intronic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1008583746 6:52930147-52930169 CTTTGTGTCTGAAGCACTGATGG - Intergenic
1008888232 6:56454631-56454653 CTTTTGATATGAAGGACTGGAGG - Intergenic
1011034688 6:82960172-82960194 CTTTGCCTATGAAGGAGTGAAGG - Intronic
1011193045 6:84753527-84753549 CTTTTGGAATTGAGGGCTGAGGG + Intronic
1012827024 6:104159248-104159270 CTTTGGGTAGGGAGGGTAGAGGG + Intergenic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1014066836 6:117136947-117136969 CATTGGGTAAGCAGGCCTGATGG - Intergenic
1015503789 6:133960675-133960697 CTTTGGGTATAGAGGAAAAATGG + Intronic
1021267070 7:18537929-18537951 CTGAGGTTATGAAGGACTGAAGG - Intronic
1024300650 7:47885088-47885110 CTCTGGGAAAGGAGGGCTGAGGG - Intronic
1028261095 7:88666358-88666380 CTTTGGGACTGGATGACTGCAGG - Intergenic
1032859236 7:135861851-135861873 CTTTGTGTGTGGAGACCTGAAGG + Intergenic
1039617298 8:38966297-38966319 CTTTGGGGATGGGGGGATGAGGG + Intronic
1040475473 8:47773234-47773256 GTTTGGGTGTGGAGGACTGGCGG + Exonic
1042144831 8:65716884-65716906 GTGTGGGTATAGAGGTCTGAGGG - Intronic
1044768940 8:95608884-95608906 CTTTGTGTACTCAGGACTGATGG + Intergenic
1045215768 8:100146827-100146849 GTTTGGTTTTGGATGACTGAGGG - Intergenic
1046529846 8:115429560-115429582 CTTTTGGTACGGATGACTGAGGG - Intronic
1049493008 8:142914974-142914996 GGATGGGGATGGAGGACTGAAGG - Intronic
1049758381 8:144320818-144320840 CTGTGGGTATGGAGCCCTGCAGG - Intronic
1051392584 9:16581842-16581864 CTGTGGGCATGAAGGACTGCAGG + Intronic
1053158484 9:35796734-35796756 CTTTGGGTAGGTGGGGCTGAGGG + Intronic
1053380817 9:37648872-37648894 CTCTGGGTTTGGAAGACAGAAGG + Intronic
1053599355 9:39594320-39594342 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1053857060 9:42348506-42348528 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1054254169 9:62748066-62748088 CTATTGGTATGGAGGACAGAAGG - Intergenic
1054568234 9:66782236-66782258 CTATTGGTATGGAGGACAGAAGG - Intergenic
1058496188 9:105561474-105561496 CTTTGGGTTGGGAGGAGTGTAGG - Intronic
1059029247 9:110672448-110672470 CATAGGGTAGGGAGGACAGATGG + Intronic
1060415049 9:123424225-123424247 CTTGGGGTGTGCAGGATTGATGG - Intronic
1061421098 9:130473237-130473259 CTTTGGGCAAGGAGTACTGGAGG - Intronic
1061905536 9:133694783-133694805 CTTTGTGGATGGAGGATGGATGG + Intronic
1062626466 9:137445082-137445104 CTTTGGGTGTGGAGGAATTCTGG - Intergenic
1186501599 X:10055262-10055284 CTTTGAGAATGGAGGAAGGAAGG + Intronic
1186617413 X:11203793-11203815 GTTTGAGTATGTAGGAGTGAGGG - Intronic
1191796402 X:65026189-65026211 CTTTGGGGAGGAAGGAATGAAGG + Intronic
1192007331 X:67231228-67231250 CTTTTGGCTTGCAGGACTGAAGG - Intergenic
1196888782 X:120272336-120272358 CTTAGGGTATGGGAAACTGAAGG + Intronic
1198164023 X:134035832-134035854 CTTAGGGTAAGGAGGATTCAAGG + Intergenic
1198425585 X:136516499-136516521 ATTTGGGTGGGGAGGAGTGATGG - Intergenic
1200074231 X:153543394-153543416 CTTTGGGGATGGTGGTCTCAGGG - Intronic