ID: 1076773029

View in Genome Browser
Species Human (GRCh38)
Location 10:132677394-132677416
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076773024_1076773029 24 Left 1076773024 10:132677347-132677369 CCATCTGGTCACTCATGTATCTC 0: 1
1: 0
2: 1
3: 16
4: 261
Right 1076773029 10:132677394-132677416 CAGAGGAAGGAGAAAGTGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr