ID: 1076778691

View in Genome Browser
Species Human (GRCh38)
Location 10:132711886-132711908
Sequence CCAGAGGCTCAGAGGGTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 354}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076778691_1076778699 -9 Left 1076778691 10:132711886-132711908 CCTGGTACCCTCTGAGCCTCTGG 0: 1
1: 0
2: 5
3: 35
4: 354
Right 1076778699 10:132711900-132711922 AGCCTCTGGGAGGCTTCCTGGGG No data
1076778691_1076778703 5 Left 1076778691 10:132711886-132711908 CCTGGTACCCTCTGAGCCTCTGG 0: 1
1: 0
2: 5
3: 35
4: 354
Right 1076778703 10:132711914-132711936 TTCCTGGGGAAGACAGTGGGAGG No data
1076778691_1076778706 22 Left 1076778691 10:132711886-132711908 CCTGGTACCCTCTGAGCCTCTGG 0: 1
1: 0
2: 5
3: 35
4: 354
Right 1076778706 10:132711931-132711953 GGGAGGAGCAGTCCATGTGGAGG No data
1076778691_1076778707 23 Left 1076778691 10:132711886-132711908 CCTGGTACCCTCTGAGCCTCTGG 0: 1
1: 0
2: 5
3: 35
4: 354
Right 1076778707 10:132711932-132711954 GGAGGAGCAGTCCATGTGGAGGG No data
1076778691_1076778698 -10 Left 1076778691 10:132711886-132711908 CCTGGTACCCTCTGAGCCTCTGG 0: 1
1: 0
2: 5
3: 35
4: 354
Right 1076778698 10:132711899-132711921 GAGCCTCTGGGAGGCTTCCTGGG No data
1076778691_1076778705 19 Left 1076778691 10:132711886-132711908 CCTGGTACCCTCTGAGCCTCTGG 0: 1
1: 0
2: 5
3: 35
4: 354
Right 1076778705 10:132711928-132711950 AGTGGGAGGAGCAGTCCATGTGG No data
1076778691_1076778702 2 Left 1076778691 10:132711886-132711908 CCTGGTACCCTCTGAGCCTCTGG 0: 1
1: 0
2: 5
3: 35
4: 354
Right 1076778702 10:132711911-132711933 GGCTTCCTGGGGAAGACAGTGGG No data
1076778691_1076778701 1 Left 1076778691 10:132711886-132711908 CCTGGTACCCTCTGAGCCTCTGG 0: 1
1: 0
2: 5
3: 35
4: 354
Right 1076778701 10:132711910-132711932 AGGCTTCCTGGGGAAGACAGTGG No data
1076778691_1076778708 24 Left 1076778691 10:132711886-132711908 CCTGGTACCCTCTGAGCCTCTGG 0: 1
1: 0
2: 5
3: 35
4: 354
Right 1076778708 10:132711933-132711955 GAGGAGCAGTCCATGTGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076778691 Original CRISPR CCAGAGGCTCAGAGGGTACC AGG (reversed) Intronic
900144194 1:1150839-1150861 CTAGAGGCCCAGAGGGAATCTGG - Intergenic
900391121 1:2434380-2434402 CCAGAGGCCCTGTGGGTGCCCGG - Intronic
900424742 1:2571400-2571422 CCAGGGACACAGAGGGGACCTGG + Intergenic
900482838 1:2907673-2907695 CCAGATGCTCAGAGGGGAGATGG + Intergenic
900502068 1:3011257-3011279 CCAGAGTCTCAGAGGGAGCAGGG - Intergenic
900534386 1:3169785-3169807 CCCGAGGCTCGGGGGGAACCAGG - Intronic
900613256 1:3553288-3553310 CGCCAGGCTCACAGGGTACCCGG - Intronic
901027499 1:6286344-6286366 ACAGAGGCTCAGAGAGGACCAGG - Intronic
901651782 1:10747172-10747194 CCAGAGGCTCAGAGGGTATGGGG - Intronic
902381769 1:16056146-16056168 GCAGAGGCTGACAGGGGACCTGG + Intronic
902437969 1:16410140-16410162 CCAAAGGCTCAGAGAGTAAGGGG - Intronic
902470636 1:16645767-16645789 CCAGAGGCTCAGTGGGCATGGGG + Intergenic
902488167 1:16761693-16761715 CCAGAGGCTCAGTGGGCATGGGG - Intronic
902767784 1:18628704-18628726 CCTGAGGTTCTGAGGGTCCCTGG + Intergenic
903952782 1:27005843-27005865 CCAGAGGCGCAGAATGTGCCAGG - Exonic
904697455 1:32338233-32338255 CCAGAGCCCCAGAGGGAGCCTGG + Intergenic
905224429 1:36469788-36469810 CCAGAGGCTGTGAGGGTCTCGGG + Exonic
905548060 1:38815950-38815972 CCTGAGGCTTAGGAGGTACCAGG - Intergenic
905614730 1:39387869-39387891 TCAGAGGCTCAGGGAGTTCCAGG + Exonic
907291888 1:53419878-53419900 CCATAGGCACAGAAGGTACAGGG - Intergenic
907406018 1:54253946-54253968 TCAGAGGCTCAGAGGGGACCTGG + Intronic
908480656 1:64535803-64535825 CCAGAGGCCCAGAGGAAGCCAGG - Intronic
910139192 1:84008006-84008028 TCTGAGGCTCTGAGAGTACCAGG - Intergenic
912458341 1:109814644-109814666 CCAGAGGCTCAGTGGGATTCAGG - Intergenic
912489715 1:110055424-110055446 CCTGAGGCTCAGCAGGTCCCAGG - Intronic
915655415 1:157355469-157355491 CCAGAGGGTAAGAGGTTACTGGG + Intergenic
918078713 1:181189987-181190009 CTGGAGGCCCAGAGGGCACCCGG - Intergenic
920075906 1:203336345-203336367 CCAGAGGCTCAGCTGGCAACAGG + Intergenic
920430278 1:205914447-205914469 CCAGAGACTCAGAGGGGAAGAGG - Exonic
920502714 1:206495511-206495533 CCAGAGTTTCAGAGGGTCCTTGG + Intronic
922086962 1:222358689-222358711 CCAGAGGCTGGGAGGGTATTGGG + Intergenic
923596765 1:235366431-235366453 CCAAAGGCTCAGAGGTTAGGGGG + Intergenic
924112525 1:240714089-240714111 GCAGGGGCTCTGAGGGTAGCTGG - Intergenic
924177684 1:241409214-241409236 CCAGTGGATCAGAGACTACCAGG - Intergenic
1062904605 10:1171193-1171215 CAAGAGGCTCAGAAGGGAGCAGG - Intergenic
1062984004 10:1749811-1749833 CCAGAAGCTCAGAGAACACCAGG + Intergenic
1063073678 10:2692425-2692447 CCAGGCGCTCACAGGGTCCCTGG + Intergenic
1063450561 10:6147467-6147489 TCAGGGGCCCAGCGGGTACCAGG + Intronic
1067042231 10:42961112-42961134 CCAGAGGAGCAGACGGGACCAGG + Intergenic
1071885143 10:89941520-89941542 CCATAGGCTCAGGGGTTGCCAGG - Intergenic
1073143024 10:101261380-101261402 CCCGGGGCTCAGAGGGGGCCAGG + Intergenic
1073330605 10:102667959-102667981 GGAGAGGGTTAGAGGGTACCCGG + Intergenic
1075086823 10:119419231-119419253 CCAGAAGCTCAGAGGGCTCTGGG - Intronic
1075259781 10:120953239-120953261 CAAGAAGCTCATGGGGTACCAGG - Intergenic
1075512621 10:123084597-123084619 CCAGAGTCTCCGAGGGAACAAGG + Intergenic
1075908525 10:126103904-126103926 CCAAATGCTCAGAGGTCACCAGG + Intronic
1076554371 10:131311996-131312018 CCAGAGGGCCAGAGGCCACCAGG - Intergenic
1076590384 10:131578380-131578402 GCAGAGGCTCTGCGGGAACCAGG - Intergenic
1076756570 10:132575728-132575750 CCAGAGGGACACAGGGAACCGGG - Intronic
1076778691 10:132711886-132711908 CCAGAGGCTCAGAGGGTACCAGG - Intronic
1077152102 11:1077117-1077139 TCAGAGGCCCTGAGGGCACCAGG - Intergenic
1077187283 11:1240969-1240991 CCTGAGGCAGAGAGGGTACCAGG + Exonic
1077423243 11:2462750-2462772 CCACAGGCAAAGAGGGTGCCGGG + Intronic
1078560198 11:12364533-12364555 CTAGAGTCTCAGAGGGAACATGG - Intergenic
1080521087 11:33068445-33068467 GCAGGGGCTCAGAGTATACCAGG - Intronic
1081635415 11:44718343-44718365 CCAGAGTCTCAGAGGGAGCATGG - Intergenic
1081635767 11:44720775-44720797 TCAGAGTCTCACAGGGCACCTGG - Intergenic
1083322718 11:61857254-61857276 ACAGAGGCTCAGAGAGTCCCAGG + Intronic
1083489795 11:63007868-63007890 CCTGAGGCTCAGAGGGTAAGTGG + Intronic
1083614297 11:64018757-64018779 ACTGAGGCTCACAGAGTACCCGG + Intronic
1083626525 11:64074731-64074753 CCAGAGGCCCAGGGGTGACCAGG + Intronic
1083664128 11:64265492-64265514 CCAGACACTCACAGGGCACCTGG - Exonic
1083901196 11:65644338-65644360 CCTATGGCTGAGAGGGTACCAGG + Intronic
1084171070 11:67401377-67401399 CCCGAGGCGCTGAGGGTAGCTGG - Intronic
1085465658 11:76721728-76721750 CCAGAGGCTCAGCGGAAGCCAGG - Intergenic
1086017581 11:82184960-82184982 GCAGATGCTCAGAGGGCACTGGG - Intergenic
1086085338 11:82947439-82947461 CCAGAGGCTGAGAGGGGAAAGGG + Intronic
1087550605 11:99642755-99642777 CCAGAGGCTGAGAGGGTAGAGGG - Intronic
1088535827 11:110859824-110859846 CCAGAGGCTAAGAGAGTAAACGG + Intergenic
1090087609 11:123664463-123664485 CCAGAGACTAAGACAGTACCTGG - Intergenic
1090515205 11:127417662-127417684 CCAGTGGCTGGGAGGGTACTGGG - Intergenic
1091282869 11:134391842-134391864 TCTGAGGCTCTGAGGGCACCCGG - Exonic
1091292959 11:134452321-134452343 CCAGAGTCTCAGAGCCTGCCTGG + Intergenic
1093958756 12:25250763-25250785 CCAGAGGCTCAGCGGCTCCCAGG - Exonic
1095942977 12:47738402-47738424 CCAGAGGCCCAGCGGGGACCAGG + Intronic
1096124501 12:49109806-49109828 CCAGGGCTTCAGAGGGTACCTGG - Intronic
1096371935 12:51076127-51076149 CCAGAGTCCCAGAGAGTTCCAGG - Intronic
1097287556 12:57889496-57889518 CCTGAGGCCCAGAGGGAAGCAGG + Intergenic
1097517486 12:60623289-60623311 CCAGAGGTTCAAAGGGGAGCTGG + Intergenic
1098097931 12:66979887-66979909 TAAGAGTCTCAGAGGGAACCTGG + Intergenic
1098457442 12:70690894-70690916 CAAAAAGCTCAGAGTGTACCAGG - Intronic
1098576228 12:72046388-72046410 ACAGAGGCTGAGTGGGAACCTGG - Intronic
1101378744 12:104193834-104193856 CCAGAGGCTGAGAAGGTAGAGGG - Intergenic
1101560972 12:105857709-105857731 CCACGGGCACAGAGGGCACCAGG + Intergenic
1101738439 12:107481398-107481420 CCTGGTGCTCAGAGGGAACCAGG - Intronic
1101774426 12:107780677-107780699 TCAGAGGCTCAGAGGTGACAAGG + Intergenic
1101963673 12:109267757-109267779 CCAGAGGATCACAGGGCCCCAGG - Exonic
1102009678 12:109610606-109610628 CCAGTGTCTCAGAGGGTCCCTGG - Intergenic
1103564805 12:121810253-121810275 CCAGAGGCTCAGCAGGTGGCAGG - Exonic
1104239582 12:126975000-126975022 CCAGAAGGTCAGAGGGTGGCAGG - Intergenic
1104428523 12:128697431-128697453 CCAGAGGTTCAGAGGGAGCAGGG + Intronic
1104745384 12:131207349-131207371 TCAGAGGCTCAGAGGTCCCCAGG + Intergenic
1104788955 12:131469757-131469779 TCAGAGGCTCAGAGGTCCCCAGG - Intergenic
1104931043 12:132339637-132339659 CCACAGGCCCAGTGGGTCCCGGG - Intergenic
1105508787 13:21034214-21034236 CCTGAGGCTCAGAAGGTGCATGG + Intronic
1108518219 13:51222396-51222418 CCAGACGCTCGGAGGGAGCCCGG + Exonic
1110569346 13:76988153-76988175 CCAGAGCCTCAGTGGCTGCCTGG - Intergenic
1112470746 13:99686353-99686375 CCAGATGCTCAGAGGGGAGGTGG - Intronic
1112791017 13:103002241-103002263 CCAGAGCATCAGATTGTACCTGG + Intergenic
1112929140 13:104713529-104713551 GCTGTGGCTCAGAGGGTCCCAGG - Intergenic
1113140577 13:107144355-107144377 CAAGAGGCTCAGAGGGAGCATGG + Intergenic
1114066431 14:19062704-19062726 CCTGAGGCTCGGAGGGACCCAGG - Intergenic
1114095837 14:19337320-19337342 CCTGAGGCTCGGAGGGACCCAGG + Intergenic
1115324657 14:32126304-32126326 CTAGAGTCTCAGAGGGAACATGG - Intronic
1116083892 14:40209573-40209595 CTAGAGGCTCAGAGAACACCAGG + Intergenic
1117182361 14:53203813-53203835 CAAGAAGCTCAGAGAGCACCTGG + Intergenic
1119321166 14:73731350-73731372 CCAGAGCCTCAGAGGGAGTCAGG - Intronic
1119479867 14:74952431-74952453 CCTGAGGCTCAGAGAGGCCCTGG - Intronic
1119749107 14:77065024-77065046 CCAAAGGCTCAGGGGGAAGCAGG - Intergenic
1120137081 14:80882891-80882913 CCAGAGGCTGAAAGGGTAGTGGG + Intronic
1120324357 14:83006470-83006492 CCAGAGGCTCAGGGAATAGCTGG - Intergenic
1120976103 14:90249464-90249486 CGAGAGGCTCAGCAGGTATCTGG + Intergenic
1122355822 14:101122300-101122322 CGAGAGGCTGAGGGGGAACCTGG + Intergenic
1122922917 14:104887341-104887363 CCACAGGCCCCGAGGGTCCCTGG + Exonic
1122980697 14:105191243-105191265 CCAGAGGCTCAGAGGTGCCCCGG - Intergenic
1123167921 14:106344190-106344212 CCAGAGGCTCCGAGGGGAACTGG + Intergenic
1123170559 14:106368903-106368925 CCAGAGGCTCCGAGGGGAACTGG + Intergenic
1124242265 15:28038359-28038381 CCAGAGGCTCTGACTGTACACGG - Intronic
1127284872 15:57523693-57523715 CCAGACCCTCAGAGGGGACTGGG - Intronic
1128084194 15:64874611-64874633 ACAAAAGCTCAGAGGGGACCTGG + Intronic
1129234120 15:74213719-74213741 CCAGAGGCCCACAGGGCAACAGG - Intergenic
1129767459 15:78179274-78179296 CCATAGGTTCAGGGGGCACCTGG + Intronic
1131095651 15:89652902-89652924 CTGGAGGCTCAGAGGCTGCCAGG - Exonic
1131668877 15:94598296-94598318 CCAGAGGATCAGAGGCTGCATGG + Intergenic
1132947032 16:2537667-2537689 ACTGAGGCTCAGAGGGGACCAGG - Intergenic
1132968656 16:2673725-2673747 ACTGAGGCTCAGAGGGGACCTGG + Intergenic
1133317493 16:4893498-4893520 CCTGAGGCTCTGGGGGTACCGGG - Intronic
1134598730 16:15516541-15516563 CCAGAGGTTAAGAGGCAACCTGG + Intronic
1135547718 16:23377088-23377110 CCAGAGGCTCAGCAGGGAACAGG + Intronic
1136381484 16:29898088-29898110 GCAGGGGCTCAGATGGTCCCAGG + Intronic
1137036705 16:35574762-35574784 CGCGTGGCTCAGAGGGCACCAGG - Intergenic
1137624686 16:49900192-49900214 CCAGGGGCCCAGAGGGCACCTGG - Intergenic
1138121081 16:54401610-54401632 CCAGATGCTCAGATGCTACTTGG - Intergenic
1138510057 16:57503527-57503549 CCAGAGGCTCTCCGGCTACCCGG - Intergenic
1139422875 16:66859713-66859735 CCTGAGGCTTAGAGAGCACCAGG + Intronic
1141248514 16:82333195-82333217 CCAGTGGCTCAGAAGGAAACAGG + Intergenic
1141291581 16:82722773-82722795 CAAGATGCTCACAGGGTACCAGG + Intronic
1141368099 16:83462894-83462916 CCAATGGCTCAGAGGCCACCAGG - Intronic
1141792087 16:86243763-86243785 GCACGGGCTCAGAGGGCACCTGG + Intergenic
1142001998 16:87669490-87669512 ACTGAGGCTCAGAGGCTGCCAGG - Intronic
1142364716 16:89644158-89644180 CCAGAGGCTCAGGGGGACCACGG + Intergenic
1143003356 17:3809990-3810012 CCAGAGGCTAAGAGGGAAGAGGG + Intergenic
1143898621 17:10156595-10156617 CCAGAGGGTGCGAGGGTCCCTGG - Intronic
1144641320 17:16938897-16938919 GCAGAGCCCCAGTGGGTACCCGG + Intronic
1144723944 17:17491905-17491927 CCATAGGATCAGTGTGTACCAGG + Exonic
1144873696 17:18385400-18385422 GCAGAGCCCCAGTGGGTACCCGG - Intronic
1145158769 17:20560381-20560403 GCAGAGCCCCAGTGGGTACCCGG + Intergenic
1146006810 17:29165795-29165817 CCACAGGCTCAGAGAGCAGCAGG + Intronic
1146896247 17:36544503-36544525 GCAGAGGCCCAGAGAGGACCTGG - Intergenic
1147584065 17:41642938-41642960 CCAGAGACTGAGACAGTACCTGG - Intergenic
1147918865 17:43904377-43904399 TCAGTGGTTCAGAGGGTGCCAGG - Intronic
1148108383 17:45131441-45131463 CCAGACTCTGAGAGGGTACCAGG + Intronic
1148390044 17:47265395-47265417 CCAGAGTCTCAGAGGGACCATGG - Intronic
1148759250 17:49991057-49991079 CCAGAGGCTCAGGAGGAACTAGG + Exonic
1149334456 17:55621156-55621178 TCAGAGGCTGAGAGGGTTCTGGG - Intergenic
1150479374 17:65497594-65497616 ACTGAGGCTCAGAGGGCCCCAGG + Intergenic
1151801000 17:76379752-76379774 CCAGAGGCCCAGAAGAGACCTGG + Intronic
1154216208 18:12418646-12418668 CAGGAGGCTCAGAGGCTTCCTGG + Intronic
1155162736 18:23208782-23208804 CCTGGGGCTCAGAGGGAACATGG - Intronic
1156072103 18:33224560-33224582 CCATAGTCTTAGAGGGTACTTGG - Intronic
1160957557 19:1700444-1700466 TCAGAGGCTGAGACGGTGCCTGG + Intergenic
1161339607 19:3734010-3734032 CTAGAGGCTCAGAGAGTGACAGG + Intronic
1161421255 19:4176990-4177012 CCAGAGACCCAGAGGGTATGGGG - Intronic
1161709984 19:5842209-5842231 ACTGAGGCTCAGAGAGCACCTGG + Intergenic
1162079192 19:8208813-8208835 CCAGAGGCTCAGGGCGCCCCGGG + Intronic
1162142542 19:8593248-8593270 CCAGAAACTCAGAAGGCACCAGG - Intronic
1162154001 19:8664460-8664482 CCTGAGGCTCAGGAGGTGCCGGG + Intergenic
1163540029 19:17902977-17902999 GCAGAAGCCCAGAGGATACCCGG - Intergenic
1163677557 19:18662922-18662944 CCAGAGTCTCAGGGTGCACCTGG + Intronic
1164458360 19:28427354-28427376 CCTTCGGCTCAGAGGATACCAGG - Intergenic
1164471914 19:28543459-28543481 CCACAGGCACAGAGAGCACCTGG + Intergenic
1165459814 19:35937622-35937644 CAAGAGTGTCAAAGGGTACCTGG - Intronic
1166538535 19:43591280-43591302 TCAGAGCCTCAGAGGGAAACAGG - Exonic
1166558750 19:43718531-43718553 CCAGTGGTTCAGAGGGTGGCGGG - Exonic
1166643300 19:44512735-44512757 ACAGAGGCTCAGAGTGGACAGGG + Intronic
1166984670 19:46652693-46652715 CCCGGGGCTCAGAGGGACCCAGG + Exonic
1168244350 19:55103681-55103703 CCTGAGTCTCAGAGGGGAGCAGG - Intronic
1168245766 19:55112567-55112589 CCCGTGGCTCAGGAGGTACCTGG + Exonic
1168290617 19:55355241-55355263 CCAGGGTCTTAAAGGGTACCTGG + Exonic
1202703031 1_KI270713v1_random:2547-2569 CCAGAGGCTCAGTGGGCATGGGG + Intergenic
925821698 2:7805234-7805256 CCAGAGGCTTTGAGGCCACCAGG - Intergenic
926072294 2:9907515-9907537 CCCGAGCCCCAGAGGCTACCTGG - Intronic
926238192 2:11065699-11065721 GCAGGTGCTCAGAGGGTAACTGG + Intergenic
926240158 2:11079194-11079216 CCAGAGGCACTGGGGGCACCTGG - Intergenic
926259125 2:11240599-11240621 CCTGGGGCTCAGAGGGTAATAGG + Intronic
927640717 2:24843874-24843896 CCAGAGGCTCAGCAGGGAGCTGG + Intronic
928224839 2:29439831-29439853 CCAGAGTCTCAGAGAGAACATGG + Intronic
929593650 2:43162419-43162441 CCTGGGGCTCAGAGGGGAGCTGG - Intergenic
930004217 2:46883015-46883037 CCAGAGACCCAGAGGGCACTTGG + Intergenic
930048082 2:47191675-47191697 CCAGAGGCTGAGAGTGGATCAGG - Intergenic
931054009 2:58448084-58448106 CCAGAGGCTTAGAGGAATCCAGG - Intergenic
932141973 2:69287055-69287077 CCAGAGGCACAGAGGGTTCCTGG + Intergenic
932882823 2:75519521-75519543 CCAGAGGCTCTGAGAGTGACAGG + Intronic
934603211 2:95674373-95674395 CAACAGGCTCAGAGGCTACATGG + Intergenic
936721470 2:115256464-115256486 CCACAGGCTCAGAGGGTCCCAGG - Intronic
937096760 2:119240669-119240691 GCAGAGACCCAGAGGGGACCAGG + Intronic
937289328 2:120772586-120772608 CCATAGGCCCAGAGGTTCCCAGG + Intronic
937436385 2:121885160-121885182 ACAGAGGCTTAGAGTGTAACTGG + Intergenic
937998139 2:127710639-127710661 GCTGAGGCAGAGAGGGTACCAGG + Intronic
941207552 2:162592635-162592657 ACAAAGGCTCTGAGGGTCCCTGG - Intronic
941743035 2:169056379-169056401 CCAGAGGTACAGAGGGGAGCTGG + Intergenic
942278529 2:174340298-174340320 CTGGAGGCCCAGAGGGTGCCTGG + Intergenic
942769637 2:179501570-179501592 CCAGAGGCTGGAAGGGTAGCGGG + Intronic
943306926 2:186274323-186274345 CCAAAGGCTGAGAAGGTACAGGG + Intergenic
944970591 2:204988331-204988353 CCAGAGGCTGAGAAGGTAGTGGG + Intronic
947586040 2:231357517-231357539 CCTGAGGCTCAGAGCGGGCCTGG - Intronic
948314490 2:237016882-237016904 CCAGAGACTCAGGGGGTCCCAGG - Intergenic
949032819 2:241805013-241805035 CCAGGGGCTCAGCGGGTAAAGGG + Intergenic
949034155 2:241808911-241808933 CCTGATGCTCAGAGGGTAACTGG - Intronic
1171037954 20:21731529-21731551 CCAGAGTCTCAGAGGGAGCCTGG + Intergenic
1172409876 20:34713020-34713042 CAAGTTGCTCAGAGGGTTCCAGG - Exonic
1173314537 20:41931431-41931453 GCTGTGGCTCAAAGGGTACCTGG - Intergenic
1173851606 20:46222052-46222074 ACAGAGGCTCAGAGAGGCCCAGG - Intronic
1174004904 20:47402782-47402804 TCTGAGGCTCTGAGGGTACAAGG + Intergenic
1174570390 20:51497180-51497202 ACAGAGCCTCGGAGGGTGCCTGG - Intronic
1175510855 20:59525162-59525184 CAAGAAGCTCAGAGAGCACCAGG - Intergenic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1176162583 20:63655360-63655382 ACAGAGGCTCAGAGAGGGCCTGG - Intergenic
1176682137 21:9824973-9824995 CCGGAGCCTCAGGGGGTGCCTGG - Intergenic
1176682416 21:9826382-9826404 CCGGAGCCTCAGGGGGTGCCTGG - Intergenic
1176682694 21:9827801-9827823 CCGGAGCCTCAGGGGGTGCCTGG - Intergenic
1176682974 21:9829198-9829220 CCGGAGCCTCAGGGGGTGCCTGG - Intergenic
1176683254 21:9830608-9830630 CCGGAGCCTCAGGGGGTGCCTGG - Intergenic
1176683533 21:9832017-9832039 CCGGAGCCTCAGGGGGTGCCTGG - Intergenic
1176683813 21:9833420-9833442 CCGGAGCCTCAGGGGGTGCCTGG - Intergenic
1176684090 21:9834829-9834851 CCGGAGCCTCAGGGGGTGCCTGG - Intergenic
1176684370 21:9836230-9836252 CCGGAGCCTCAGGGGGTGCCTGG - Intergenic
1179923147 21:44518329-44518351 CCAGTGCCCCAGAGCGTACCTGG - Exonic
1180054619 21:45351382-45351404 CCTGGGGCTCAGCGGGGACCAGG + Intergenic
1180484909 22:15785295-15785317 CCTGAGGCTCGGAGGGACCCAGG - Intergenic
1180945170 22:19688651-19688673 GCAGAGGCCCAGAGGCTGCCGGG + Intergenic
1181313879 22:21959874-21959896 CCACAGCCTCAGATGGTACCAGG + Intronic
1181329377 22:22077527-22077549 CCAGAGGCTGGGAAGGTAGCAGG - Intergenic
1181782542 22:25203576-25203598 CCAGAGTCTCAGACAGTTCCCGG + Intronic
1183309697 22:37102799-37102821 CCAGAGGCACCAATGGTACCTGG - Intronic
1183365094 22:37402762-37402784 CCAGGGGCTCGGTGGGTCCCAGG + Intronic
1183688712 22:39376276-39376298 CCAGAGGCAGAGCGGGTCCCAGG - Intronic
1184330813 22:43826327-43826349 CCACAGCCTCAGAGGGAAGCTGG - Intronic
1184668445 22:46000701-46000723 CCAGTGGCTCTGAAGGTGCCTGG + Intergenic
1185274202 22:49943358-49943380 CCACAGGCCGAGAGGGTCCCAGG + Intergenic
949327131 3:2879310-2879332 CCAGAGTCTCAAAGGGTGCATGG + Intronic
950390208 3:12690595-12690617 CCAGAGTCTGAGAGGGAACGTGG + Intergenic
951027855 3:17848430-17848452 CCAGAGACTCAAAGGCCACCTGG - Intronic
951366159 3:21785557-21785579 CCAGAGGCTGAGGAGATACCAGG - Intronic
954298794 3:49688487-49688509 CCAGAGGCTCAGTGGGCATGGGG - Intronic
954623296 3:52007805-52007827 CCACAGGCCCACAGGGTGCCGGG + Intergenic
954950395 3:54467711-54467733 CCAGAGGATGGGAGGGTACAGGG + Intronic
956707079 3:72008307-72008329 CCAGAGTTTCAGAGGGAACATGG + Intergenic
957037263 3:75305901-75305923 CCAGAGTCTCAGAGGGAGCATGG - Intergenic
958669993 3:97191468-97191490 CCAGAGGCTGGGAAGGTACTGGG - Intronic
961081095 3:124029032-124029054 CCAGAGTCTCAGAGGGAGCATGG - Intergenic
961172919 3:124811719-124811741 CCAGAGACTCTGTGGGTAGCAGG - Intronic
963105926 3:141647026-141647048 CCAGTAGTTCAGAGTGTACCAGG + Intergenic
963895596 3:150682363-150682385 CCAGAGGCTCTGAGAGCAGCAGG + Intronic
964130311 3:153279590-153279612 CCTGAGGCTCACAGGGTTTCTGG - Intergenic
964356217 3:155854188-155854210 CTAGAGGCCCAGAGGATGCCTGG + Exonic
964706722 3:159626413-159626435 CCACTGTCTCAGATGGTACCTGG + Intronic
964868599 3:161289026-161289048 CCAGAGGCTCAGGTGGTTCCAGG + Intergenic
965808387 3:172566398-172566420 CCAGAGGCTCAGAGGGTAGTTGG - Intergenic
967217918 3:187225814-187225836 CAAGAGTCTGAGAGGCTACCTGG - Intronic
967394933 3:188997535-188997557 CCAGAGGCTGAGAGGGTTACTGG + Intronic
968568180 4:1326013-1326035 CCAGGGGCTCAGAGGGGCTCAGG - Intronic
968574621 4:1359864-1359886 CCAGGGGCTGACAGGGTCCCCGG - Intronic
968861728 4:3176806-3176828 CCAGAGGCTCTGAGAAAACCAGG + Intronic
968890161 4:3364595-3364617 CCCGACGCTCAGAGGGAGCCAGG + Intronic
969605166 4:8198758-8198780 CCAGTGGCCCGGAGGGCACCCGG + Intronic
969860714 4:10033541-10033563 CCAGATGCTCAGAGGAAGCCAGG - Intronic
970419430 4:15891505-15891527 ACAGGGGCTCAGAGGGACCCAGG - Intergenic
970655068 4:18221888-18221910 CCAGAGGCACAGAGAGGAGCTGG - Intergenic
974470198 4:62309605-62309627 CACGTGGCTCAGAGGGTCCCAGG + Intergenic
975740762 4:77426662-77426684 TCACAGGCTCCCAGGGTACCAGG - Intronic
979337930 4:119485110-119485132 CCAGAGGCACAAAGAGGACCTGG + Intergenic
981637577 4:146898350-146898372 CCAGGAGCTCAGAAGGCACCAGG - Intronic
981936914 4:150248873-150248895 CCAGAGGCTCAGGTGGTCTCTGG + Intronic
983027190 4:162752770-162752792 CCAGAGGCTGAGAGTGCAGCTGG + Intergenic
986140891 5:5028609-5028631 CCAGAGGCACAGAGAGGAGCTGG + Intergenic
986735336 5:10663676-10663698 CCAGAGACGCAGAGGGGAACAGG - Intergenic
990042233 5:51389161-51389183 CCAAGGCCACAGAGGGTACCAGG - Intronic
990184728 5:53200967-53200989 CCAGATGATCAGTGAGTACCTGG - Intergenic
992840256 5:80682854-80682876 CCAGAGGCTGAGAAGGGAACTGG - Intronic
994451485 5:99950227-99950249 CCTGAGGCTCTGAGAGTACAAGG - Intergenic
994782022 5:104102017-104102039 TCAGAGGCTCAGAGGGGAAAGGG + Intergenic
995453827 5:112331579-112331601 CCAGAGCAGCTGAGGGTACCTGG + Intronic
995692089 5:114838659-114838681 CCAGAGGCTGGGAGGGTAGTAGG + Intergenic
996608879 5:125356293-125356315 CCAGAAGCTCAAAGAATACCCGG - Intergenic
997090181 5:130847278-130847300 CAAGAGCCTCAGAGGGCCCCTGG + Intergenic
997868217 5:137483493-137483515 CCAGAGCCTAGGAGAGTACCTGG + Intronic
998310059 5:141121140-141121162 ACTGAAGCTCAGAGGGTAACAGG - Intronic
998339062 5:141400149-141400171 CCTGGGGGTCAGAGGGTACAGGG - Exonic
998616372 5:143744897-143744919 CCTGAGGCTCAGAGCCTAGCTGG - Intergenic
999961707 5:156763023-156763045 ACACAGGCTCAGAGGATGCCTGG + Intronic
1001018834 5:168165581-168165603 AAAGAGGCTCACAGGGTCCCCGG + Intronic
1001085652 5:168698517-168698539 CTAGAGGCTCAGAGGGAGCATGG + Intronic
1001609965 5:172992490-172992512 GCAGGGGGTGAGAGGGTACCTGG - Intronic
1001652787 5:173327670-173327692 CGGGAGGCCCAGAGGGTCCCCGG - Intronic
1001784389 5:174399486-174399508 CAAGAGGCAGAGAGGGTCCCAGG + Intergenic
1002261134 5:177994803-177994825 TCAGAGACTCAGAGGCAACCAGG - Intronic
1002364679 5:178700681-178700703 CGAGGAGCTCAGAGGGTCCCAGG + Intergenic
1003175989 6:3752253-3752275 CCTGAGGCACGGAGGGAACCCGG - Intergenic
1004472869 6:15944700-15944722 CCAGAGCCTAACGGGGTACCTGG - Intergenic
1005166202 6:22923747-22923769 GCAGAGGATCAGAGGATACAGGG + Intergenic
1005808936 6:29501685-29501707 GCAGAGGCTGAGTGGGTGCCAGG + Intergenic
1007165063 6:39823411-39823433 CCAGAGACTCAGAGAGGAACAGG + Intronic
1007367674 6:41406368-41406390 GCAGAGGCTCAGAGGAAACCCGG + Intergenic
1007615082 6:43174821-43174843 CCAGAGGCTCAAAGGCTGCGGGG - Intronic
1008592971 6:53011877-53011899 CCACAGGCTCAGAGGGCTTCAGG + Exonic
1011129948 6:84042537-84042559 CCAGAGTCTCAGGGCATACCTGG - Intronic
1012421873 6:99074691-99074713 CAGGAGGCTCAGAGGATACCGGG + Intergenic
1015729691 6:136335143-136335165 CCAGAGCCTCAGAGGGAGCAGGG - Intergenic
1018328668 6:162704078-162704100 ACTGAGGCTCAGCGGGTACCAGG - Intronic
1018986722 6:168643419-168643441 CCTGAGGCCCTGAGGATACCAGG - Intronic
1019009812 6:168835135-168835157 AGAGAGGCTCAGAGAGTCCCAGG + Intergenic
1019034247 6:169041365-169041387 CCAGAAGCTGAGAGGGAGCCCGG - Intergenic
1019123257 6:169822314-169822336 CAAGAAGCTCAGAGAATACCTGG - Intergenic
1019266620 7:120799-120821 CCAGAGGCCCTGAGGGGTCCGGG - Intergenic
1019522720 7:1467970-1467992 CAAGAGGCCCAGAGGGTCCCAGG + Intergenic
1019714253 7:2531032-2531054 CCACAGGCTCAGAGGGGCCAGGG + Intergenic
1020117448 7:5483781-5483803 CCAGAGTCTCAGTGGGTGCAAGG + Intronic
1020841444 7:13222784-13222806 CCAGAGGCTGAGAGGTTCCTGGG - Intergenic
1021168897 7:17374015-17374037 CCTGAGGCTCAGAAGGTATGAGG + Intergenic
1023580076 7:41672282-41672304 CCAGAGTCTCAGAGTCTTCCAGG - Intergenic
1023629435 7:42148911-42148933 CCAGAGCCTCAGTGGGTAGCTGG - Intronic
1023682010 7:42696827-42696849 GCAGAGAGTGAGAGGGTACCAGG + Intergenic
1023834832 7:44062025-44062047 CCGGATGCTCAGTGGGTGCCAGG - Intronic
1024123988 7:46272991-46273013 TGAGAGGCTCTGAGGGTACTAGG + Intergenic
1024709080 7:51995472-51995494 TCAGAGGACCAGAGGGTCCCTGG - Intergenic
1025246216 7:57319487-57319509 GCAGAGGAGCAGAGGGTCCCGGG + Intergenic
1026827994 7:73596016-73596038 CCAGTGCCTCAGTGGGTCCCAGG - Intronic
1028923009 7:96327370-96327392 CCAGAGTCTCAGAGGGATCATGG + Intergenic
1029615098 7:101651282-101651304 CCAGAGGCTCAGAGAGGGCATGG + Intergenic
1029933094 7:104394288-104394310 CCAGAGGCACAGATGCAACCTGG - Intronic
1030050007 7:105529620-105529642 CCAAAGGCTGAAAGGGTAGCAGG + Intergenic
1031382583 7:121106022-121106044 CCAGAGCCTCACAGAGTTCCTGG + Intronic
1034236026 7:149570220-149570242 CCAGAGGCTCAGCAGATGCCCGG - Intergenic
1035044859 7:155957067-155957089 CCAGAGCCTCCGAGGGAACAGGG + Intergenic
1035531579 8:356398-356420 CTAGAGGCACAGAGGCTACCTGG + Intergenic
1035765366 8:2100783-2100805 CCAGAGGAGCAGTGGGTCCCCGG + Intronic
1035775187 8:2182377-2182399 CCAAATGCTCAGAGGCCACCTGG - Intergenic
1035817904 8:2561347-2561369 GCAGAGGCTCGGGGGGTACAGGG - Intergenic
1036228081 8:6976858-6976880 GCAGTGTCTCAGTGGGTACCTGG + Intergenic
1036230534 8:6995975-6995997 GCAGTGTCTCAGTGGGTACCTGG + Intergenic
1036232983 8:7015078-7015100 GCAGTGTCTCAGTGGGTACCTGG + Intronic
1037831301 8:22191228-22191250 GCAGAGGCTCAGAGGTTGCGTGG + Intronic
1037937877 8:22927538-22927560 CGGGAGGCACAGAGGCTACCAGG - Intronic
1039832674 8:41228518-41228540 CCAGAGGTACAGAGGGGAGCTGG + Intergenic
1039849807 8:41354521-41354543 CCAGAGGTACAGAGAGGACCTGG - Intergenic
1041281884 8:56218901-56218923 CCAGAGGCCCAGCGGGCACGAGG - Intergenic
1043847417 8:85178001-85178023 GCAGAGGCTCACGGGGTAACGGG + Intronic
1045062383 8:98421359-98421381 CCTGAGGCTGAGAGGGGCCCTGG + Intronic
1045371621 8:101529822-101529844 CCACAGGCTCTGAGGATGCCTGG + Intronic
1046472803 8:114700737-114700759 CCAGAGGCTGGGAGGGAAGCAGG - Intergenic
1047389608 8:124439592-124439614 CCAGAGGCTCTGTGGTTCCCAGG + Intergenic
1047611159 8:126522197-126522219 CCAGAGTCTCACAGTGTTCCTGG - Intergenic
1048831958 8:138486296-138486318 TCAGAGGATCAGAGGGTAGTAGG + Intronic
1049342966 8:142123578-142123600 CCAGGGGCTCCCAGGGTCCCCGG + Intergenic
1049696798 8:143987993-143988015 CCTGATGCTCAGAGGGCTCCAGG + Intronic
1051432162 9:16990604-16990626 CCAGAGGCTGAGAGGGACCAGGG + Intergenic
1052218468 9:25993825-25993847 CCAGAAGCTCAAAGAGTAACTGG + Intergenic
1052253747 9:26428951-26428973 CAAGATGCTCAGAGAATACCTGG + Intergenic
1052363624 9:27587340-27587362 CCAGAGGCTCAGAGGGGTAATGG - Intergenic
1052733971 9:32321254-32321276 CCAGAGGCTGGGAGGGTAGCTGG + Intergenic
1053293133 9:36895177-36895199 CGAGAGGCGCAGAGGGAAGCAGG + Intronic
1054462108 9:65470943-65470965 CAAGTGGGTCACAGGGTACCAGG + Intergenic
1056764013 9:89433708-89433730 CCAGAGGGTCACAGGGTCCGGGG + Intronic
1058127350 9:101210343-101210365 CCAGGGGCTCAGGGGTTCCCTGG + Intronic
1058694364 9:107546991-107547013 CCAGATGCTCAAATGGTGCCTGG - Intergenic
1058836104 9:108859708-108859730 GAAGAGGCACAGAGGGTAACAGG + Intergenic
1059642321 9:116229248-116229270 TCAGAGGCTTATAGGGTTCCTGG + Intronic
1059819879 9:117960320-117960342 CCAGAAGCTCAGAGGTGCCCTGG - Intergenic
1060055135 9:120406753-120406775 CCAGAGGCACTGAGGGTGTCTGG + Intronic
1060189374 9:121582362-121582384 GCTGAGTCTCAGAGGGAACCAGG + Intronic
1060487699 9:124059578-124059600 CCAGAGTCTCAGAGAGCACATGG + Intergenic
1060515509 9:124263313-124263335 CCTGAGGCTCAGAGGGAGCAAGG + Intronic
1061678484 9:132231254-132231276 CCAGACACTCACAGGGTGCCAGG + Intronic
1062056004 9:134470093-134470115 CCCGAGGCTCAGAAGTTCCCAGG - Intergenic
1062468387 9:136691556-136691578 ACGGAGGCCCAGAGGGTGCCTGG + Intergenic
1062481115 9:136752455-136752477 CCAGAGGCTCAGAGAAACCCAGG - Intergenic
1062553949 9:137105578-137105600 ACAGAGGGGCACAGGGTACCGGG - Intronic
1062635345 9:137487687-137487709 CCAGAGGAGCAGAGGCTGCCAGG - Intronic
1186963277 X:14760385-14760407 CCAGAGGCTTGGAGGGTAGTGGG + Intergenic
1187440175 X:19311109-19311131 CCACAGGCTCAGAGGCTACTGGG - Intergenic
1187632121 X:21184812-21184834 CCAGAGGCTGAGAAGGTAGTGGG + Intergenic
1189197243 X:39162600-39162622 GCAGAGCCACAGACGGTACCGGG + Intergenic
1189360770 X:40349173-40349195 CCAGAGTCTCAGAGGGAGCATGG - Intergenic
1189696022 X:43663491-43663513 ACAGAGGCTCAGAGGGGTCCAGG + Intronic
1190882579 X:54503079-54503101 ACTGAGCCTCAGAGGGTCCCTGG + Intergenic
1192817762 X:74612785-74612807 CAAGAAGGTCAGAGGGGACCAGG + Intronic
1194887922 X:99340884-99340906 CCAGAGGCTCAGAGGGGAAGAGG - Intergenic
1195750893 X:108161433-108161455 TCACAGGCTCAGAGGGTAGTGGG + Intronic
1196861411 X:120032298-120032320 TCAGTGGCTCTGAGGGTAGCTGG - Intergenic
1197925185 X:131638627-131638649 CCAGAAGCTCAGTTTGTACCAGG + Intergenic
1198577500 X:138026101-138026123 TCAGAGGATCAGTGGGTACCTGG + Intergenic
1199195834 X:145029259-145029281 CCAGAGGCTCAGAGAGTTGAAGG + Intergenic
1201511818 Y:14772475-14772497 CCAGAGGTACAAAGGGTAGCTGG + Intronic
1201680900 Y:16642818-16642840 GCAGAGGCTAAGATGATACCAGG - Intergenic