ID: 1076781326

View in Genome Browser
Species Human (GRCh38)
Location 10:132726369-132726391
Sequence CGGGAGGAGGGACCGACAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 160}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076781326_1076781342 30 Left 1076781326 10:132726369-132726391 CCCGCTGTCGGTCCCTCCTCCCG 0: 1
1: 0
2: 1
3: 20
4: 160
Right 1076781342 10:132726422-132726444 GCGGTGGATTATTTGGTTTGTGG No data
1076781326_1076781338 14 Left 1076781326 10:132726369-132726391 CCCGCTGTCGGTCCCTCCTCCCG 0: 1
1: 0
2: 1
3: 20
4: 160
Right 1076781338 10:132726406-132726428 GCCTTTCCTGAGCTCTGCGGTGG No data
1076781326_1076781336 11 Left 1076781326 10:132726369-132726391 CCCGCTGTCGGTCCCTCCTCCCG 0: 1
1: 0
2: 1
3: 20
4: 160
Right 1076781336 10:132726403-132726425 CCCGCCTTTCCTGAGCTCTGCGG No data
1076781326_1076781341 23 Left 1076781326 10:132726369-132726391 CCCGCTGTCGGTCCCTCCTCCCG 0: 1
1: 0
2: 1
3: 20
4: 160
Right 1076781341 10:132726415-132726437 GAGCTCTGCGGTGGATTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076781326 Original CRISPR CGGGAGGAGGGACCGACAGC GGG (reversed) Intronic
900088656 1:909931-909953 CGGGAGGAAGGACCGAGGGTGGG + Intergenic
902502855 1:16922263-16922285 TGGGATGAGGGAGCCACAGCAGG - Intronic
902714178 1:18261112-18261134 TGGGAGGAGGAACAGAGAGCTGG - Intronic
903016684 1:20366321-20366343 CGGGAGTGGGGACCGACGGGCGG - Intergenic
905034242 1:34906898-34906920 CGGCAGGAGGGAGTGACAGCAGG + Intronic
905283721 1:36865688-36865710 GGGGAGGAAGGACAGTCAGCTGG + Intronic
907304564 1:53506543-53506565 CGGAGGGTGGGAGCGACAGCAGG + Exonic
914256234 1:145962568-145962590 CGGGAGGAGGGACCAGGATCCGG - Exonic
914824669 1:151132521-151132543 CGGGAGGAGGGCCCGACGAGGGG + Exonic
915310487 1:155003824-155003846 TGGGAGGAGGGAGAGAAAGCTGG - Intronic
916885152 1:169060179-169060201 TGGGCGGAGGGCCCCACAGCTGG - Intergenic
917930698 1:179820733-179820755 AGGGAGGAGGGACTGAGTGCAGG - Intergenic
919851912 1:201678788-201678810 TGGGAGGGGGGACAGACAGAGGG - Intronic
920255378 1:204650870-204650892 CGGAAGGAATGACAGACAGCAGG + Intronic
921944569 1:220877914-220877936 CGGGAGGAGGGAGAGAGAGAGGG + Intergenic
922500791 1:226095538-226095560 AGGGTGGAGGGAGCGAAAGCAGG + Intergenic
923092936 1:230753395-230753417 CTGGAGGAGTGACAGACACCAGG - Intronic
923216659 1:231854537-231854559 CAGGAGGAGAGGCTGACAGCAGG - Intronic
924559179 1:245143438-245143460 CGGGTGGACGGACAGACAGGTGG - Intergenic
1062770105 10:92420-92442 CTGGAGCAGGCACTGACAGCAGG + Intergenic
1066444601 10:35470274-35470296 CAGGTGGAGAGACCGACAGAGGG + Intronic
1069388909 10:67911727-67911749 CGGAAGGAAGGACAGACAGAAGG - Intronic
1070314297 10:75295408-75295430 CGGGAGCTGGGAGCGAGAGCAGG + Intergenic
1070535733 10:77375927-77375949 CGGGAGGAGGGGAAGGCAGCAGG - Intronic
1070755431 10:78989094-78989116 GGGGAGGAGGGGCTGAAAGCAGG - Intergenic
1075040490 10:119103955-119103977 AGGGAGGCGGGTCCTACAGCGGG + Intergenic
1076781326 10:132726369-132726391 CGGGAGGAGGGACCGACAGCGGG - Intronic
1076838207 10:133031901-133031923 CGGGAGGATGGACAGCCAGCAGG - Intergenic
1078257869 11:9675423-9675445 AGGGAGGAGGGAGGGACAGAGGG + Intronic
1082035533 11:47642477-47642499 CGGGCGGACGGACAGACAGACGG + Exonic
1083184252 11:61008217-61008239 GGGGAGGAGAGACCCAGAGCGGG - Intronic
1083457097 11:62786665-62786687 CGGGAGGCCGGACCCAAAGCTGG - Exonic
1083596486 11:63920363-63920385 CGGGAGGAGGGAGCGGCAAGGGG - Intergenic
1084118584 11:67056143-67056165 CGGGAGTAGGGACAGGCAGCGGG - Intergenic
1084361449 11:68670639-68670661 CGGGCGGAGGGGAGGACAGCAGG + Intergenic
1085309656 11:75508754-75508776 GGGGAGTAGGGGCAGACAGCTGG - Intronic
1087756944 11:102064274-102064296 CAGGAGGAGGGACTGACATCGGG - Intronic
1089163139 11:116454994-116455016 TGAGAGGTGGGACAGACAGCTGG - Intergenic
1091055384 11:132413367-132413389 CTGGTGGATGGACTGACAGCTGG + Intergenic
1091121944 11:133064470-133064492 TGGGAGAAGGGACGGCCAGCTGG + Intronic
1091848069 12:3672893-3672915 CAGGAGGAGGGACATTCAGCAGG + Intronic
1092050161 12:5463545-5463567 CGGTAGGAGGGACAGACAGAAGG + Intronic
1092531714 12:9350573-9350595 CGAGAGGAGGCACAGACACCAGG - Intergenic
1094502580 12:31034390-31034412 CGAGAGGAGGCACAGACACCAGG - Intergenic
1096156599 12:49344961-49344983 TGGGAGGAGGGAGGGACAGCAGG - Intergenic
1096525570 12:52208091-52208113 AGGGAGCAGGTACTGACAGCAGG - Intergenic
1099015334 12:77337398-77337420 AGGAAGGAGGGACAGAAAGCAGG - Intergenic
1102989380 12:117303798-117303820 AGGGAGGATGGCCCAACAGCAGG + Intronic
1105430475 13:20332840-20332862 CAAGAGGAGGGACTGACATCAGG - Intergenic
1113056527 13:106273979-106274001 CAGGAGGAGGGACCAGCAGATGG - Intergenic
1113636543 13:111922866-111922888 CGGGAGGACGGGCAGACGGCAGG + Intergenic
1114318361 14:21526417-21526439 CGGGAGAAGGGAGCGCTAGCGGG + Intronic
1115721486 14:36166134-36166156 CGGGTGGATGGACAGACAGGTGG - Intergenic
1118038266 14:61891545-61891567 GGGCTGGAGGGACCAACAGCTGG + Intergenic
1118857887 14:69638217-69638239 CAGGAGGAGGGACAGAAAACGGG - Intronic
1121308646 14:92923199-92923221 CGGGAGGATCGACCGACAGACGG + Exonic
1122532479 14:102438222-102438244 CGGGAGCAGGGAGCGGGAGCAGG - Intronic
1126348315 15:47718586-47718608 CGGGAGGAGACACCGGGAGCCGG - Exonic
1126405068 15:48315193-48315215 TGGGAGGAGTGGCCGACAGTGGG - Intergenic
1128302509 15:66575414-66575436 CGGGTGGAGGGAGAGACAGAAGG + Intergenic
1129144202 15:73632970-73632992 CGAGAGGAGGTACCGGCTGCGGG - Intronic
1129605570 15:77023389-77023411 CGGGCGGAGGGGCAGAGAGCAGG + Intronic
1129847505 15:78774701-78774723 CGGAAGGAGGGGCGGCCAGCAGG + Exonic
1130254400 15:82319208-82319230 CGGAAGGAGGGGCGGCCAGCGGG - Intergenic
1130600565 15:85270762-85270784 CGGAAGGAGGGGCGGCCAGCGGG + Intergenic
1131161350 15:90106972-90106994 GGGGAGGGGGCACAGACAGCTGG - Intergenic
1131180116 15:90233765-90233787 CGGGAGCAGGGTCCGGGAGCTGG - Intronic
1132499064 16:276653-276675 CCGGATAAGGGACCCACAGCAGG - Intronic
1132519553 16:381162-381184 TGGGAGGAGGGACTCCCAGCTGG - Intronic
1132933850 16:2471444-2471466 CGGGCGGAGGCACCGGGAGCGGG + Intergenic
1133055390 16:3143199-3143221 TTGGAGGAGGGGCTGACAGCGGG + Intergenic
1133107880 16:3525525-3525547 GGGGGGGAGGGACAGACAGAGGG - Intronic
1134865331 16:17601897-17601919 AGGGGGAGGGGACCGACAGCAGG - Intergenic
1135728035 16:24872277-24872299 CGGGATGAGGGAGGGACTGCAGG - Intronic
1139419748 16:66843135-66843157 GGAGAGGAGGGACAAACAGCAGG + Intronic
1139423080 16:66861153-66861175 CGGAAGGAAGGACGGACAGAAGG + Intronic
1141764246 16:86048272-86048294 GGGGAGGAGGGAGCGCCAGCAGG - Intergenic
1142127873 16:88419222-88419244 CGGAAGGGGGGTCAGACAGCAGG + Intergenic
1145883376 17:28367323-28367345 TGGGAGGAGGGAGCTACAGAGGG + Exonic
1145898272 17:28473520-28473542 AAGGAGGAGGGACCCACAGGCGG - Exonic
1145899088 17:28478287-28478309 TGGGAGGACTGACTGACAGCTGG - Intronic
1148875434 17:50684220-50684242 GGTGGGGAGGGACAGACAGCAGG + Intronic
1149865689 17:60149909-60149931 CGGGAGGGAGCCCCGACAGCTGG - Intergenic
1149868679 17:60164323-60164345 GGGGAGGAGGGAAGGACAGAAGG - Intronic
1151301970 17:73233017-73233039 CGGGAGGAGGGAAAGGCGGCTGG + Intronic
1151313792 17:73310225-73310247 GTGGAGGAGGGACCACCAGCAGG - Intronic
1152569323 17:81114773-81114795 CGGGAAGAGGCACAGGCAGCCGG - Intronic
1159793059 18:72808167-72808189 CAGGAGGAGGGAGAAACAGCAGG + Intronic
1160904321 19:1445393-1445415 CGGGAGGTGGGAGCCACCGCGGG - Intergenic
1161230419 19:3172298-3172320 GGGGAGGAGGGGCCGGCAGCTGG - Intergenic
1161261725 19:3341550-3341572 AGGGATGAGGGATAGACAGCTGG - Intergenic
1161475652 19:4483414-4483436 CAGGAGGAGGGAACCACAGGAGG - Intronic
1161767523 19:6215717-6215739 CGGGAGGAGGGGCTGACTGCCGG + Intronic
1162516524 19:11151478-11151500 CGGGAGGGCGGACAGACAGCGGG - Intronic
1162566338 19:11447305-11447327 CTGCAGGGAGGACCGACAGCTGG - Intronic
1162771957 19:12954405-12954427 GGAGAGGAGGGCCCGACTGCAGG - Exonic
1163236787 19:16034511-16034533 TGGGAGGAGGCTCAGACAGCAGG + Intergenic
1163534995 19:17871997-17872019 CAGGGAGAGGGACAGACAGCCGG + Exonic
1163863098 19:19752783-19752805 TGGGAGGAGGCACAGACAGCAGG - Intergenic
1166182410 19:41118217-41118239 AGGAAGGAGGGACCAACAGAAGG + Intronic
1167139050 19:47636964-47636986 GGGAAGGAGGGCCCCACAGCAGG - Intronic
1167216922 19:48170971-48170993 TGGGAGGAGGGGCCCACAGCTGG + Intronic
1167690874 19:50983169-50983191 AGGGAGGAGGGACTGAGACCTGG - Intronic
925142776 2:1561388-1561410 TGGGAGGATGGACTGACAGCGGG - Intergenic
925277542 2:2661107-2661129 TGTGGGGAGGGACAGACAGCAGG + Intergenic
925423062 2:3727166-3727188 GGGGAGGAGGGACAGAAAGGGGG - Intronic
927209123 2:20627917-20627939 GGGGAGGAGGGATGGACAGGTGG + Intronic
927857491 2:26536588-26536610 CTGGAGGAGGGGGAGACAGCTGG + Intronic
929905987 2:46047011-46047033 CAGGAGAAGGGACAGAGAGCAGG - Intronic
930800419 2:55437939-55437961 TGGGAGCAGGCACTGACAGCAGG - Intergenic
931250852 2:60529515-60529537 AGGGAGGAGGGACAGAAAGAGGG - Intronic
932337080 2:70937644-70937666 AGGGAGGAGGGACGGCCTGCAGG - Intronic
947716211 2:232340103-232340125 TTGGAGGAGGGAGTGACAGCAGG - Intronic
1172189580 20:33053900-33053922 TGGGTGGAGGAACCGACAGGAGG + Intergenic
1173176861 20:40771279-40771301 CGAGGGGAGGAACTGACAGCAGG + Intergenic
1174180199 20:48669584-48669606 GGGGAGGAGGGACAGAAAGAAGG + Intronic
1174918902 20:54681601-54681623 CAGAAGGAGGGACAGTCAGCAGG + Intergenic
1175226130 20:57444980-57445002 GGGGAGGAGGGAGGGGCAGCAGG + Intergenic
1176057147 20:63154850-63154872 CGGGAGGAGGGAGGGAAAGGGGG - Intergenic
1176078643 20:63260711-63260733 CGGGAGGAGGGACGGCAGGCCGG - Intronic
1179313822 21:40223125-40223147 CGGGAGCAGGGACTGAGGGCAGG - Intronic
1179399737 21:41072728-41072750 GGGGATGAGGAACGGACAGCAGG + Intergenic
1179932888 21:44582572-44582594 CAGGAGAAGGGAGCGACAGAGGG - Intronic
1180087759 21:45515720-45515742 CAGGAGGATGGACAGCCAGCTGG + Exonic
1181047181 22:20220640-20220662 CTGGAGGAGGGAGGGACAGCAGG + Intergenic
1181382866 22:22520844-22520866 AGGGAGGAGGGAGAGACAGAGGG - Intergenic
1184389628 22:44195763-44195785 TGGGAGGAGGGAGTGCCAGCTGG + Intronic
1185344472 22:50305338-50305360 GGGGAGGAGGAGCCGGCAGCTGG - Intronic
950143238 3:10629608-10629630 CAGGTGGAGGGTCCCACAGCTGG + Intronic
950371409 3:12533957-12533979 CAGGAGGAGGGACCCACAGAGGG + Intronic
954130964 3:48560805-48560827 CAGGGGGAGGGACCGCCAGCTGG - Intronic
954796006 3:53161645-53161667 CGGGTGGAGGGGCCGGGAGCGGG - Intronic
956221585 3:66909822-66909844 TGGGAGGAGGGAAAGACAGGGGG - Intergenic
959863739 3:111243150-111243172 TGGGAGCAGGCACTGACAGCAGG + Intronic
962318774 3:134374595-134374617 CGGGAGGAGGGAGCGGGAGAAGG - Intronic
962444567 3:135453099-135453121 CGGGAGGAGGGGCCGTCAGCAGG - Intergenic
962996613 3:140635213-140635235 GGGGAGCAGGGACCAACAGAAGG - Intergenic
968075420 3:195813455-195813477 CAGCAGGAGGGACCTACTGCAGG + Intergenic
968617332 4:1583674-1583696 CGGGAGGAGGGACAGGTATCAGG - Intergenic
982278196 4:153658464-153658486 GGGCAGGCGGCACCGACAGCTGG + Intergenic
986210629 5:5668025-5668047 CTGGAGGAGGCACTCACAGCAGG - Intergenic
990235349 5:53761441-53761463 CAGGAGGAGGGACAGACCTCTGG + Intergenic
990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG + Exonic
999441467 5:151604349-151604371 CTGGAGGAGGGACAGAGATCAGG - Intergenic
1001557008 5:172643433-172643455 CTGGAGGAGGTAACGACAACTGG - Intronic
1002809528 6:613695-613717 CGGGAGGAGGCATCCACTGCTGG + Intronic
1002925328 6:1602406-1602428 CTGGAGGAGGGATGGGCAGCAGG - Intergenic
1003625809 6:7740234-7740256 CGTGAGGAGGCACTCACAGCTGG - Intronic
1004398840 6:15270124-15270146 CGGAAGGACGGACGGACAGATGG - Intronic
1007433064 6:41787471-41787493 CCGGAGGTGGGACCGGGAGCAGG + Intronic
1007521336 6:42453176-42453198 GGGGAGGAGGGACGGCCACCGGG + Intergenic
1012980978 6:105830818-105830840 CTGGAGGAGGGAAGGGCAGCTGG + Intergenic
1013587612 6:111593648-111593670 AGGGAGGAGGGAAGGCCAGCCGG - Intronic
1013803269 6:113970739-113970761 AAGGAGGAGGGACCGACATTTGG - Intronic
1017856641 6:158355567-158355589 GGGGAGGAGGGACTGGGAGCTGG + Intronic
1019732302 7:2634845-2634867 CCGGACGAGGGACCTACAGCAGG - Intronic
1021828048 7:24573740-24573762 GGGGAAGAGGGACCGGCAGGCGG + Intronic
1022286349 7:28958327-28958349 CGGGAGGAGGGAGCAAGACCCGG + Intergenic
1022427599 7:30284319-30284341 CGGGAGGAGGGGCCGCCTTCTGG + Exonic
1023761110 7:43466002-43466024 GGGGAGGAGGGAGGGACAGAGGG + Intronic
1027829773 7:83162781-83162803 ATGGAGGAGGCACCGGCAGCGGG - Exonic
1029421572 7:100474571-100474593 CTGGAGGAGGGAAGGACTGCGGG - Intronic
1029440988 7:100586466-100586488 CGGGCCGAGGGACCGCAAGCAGG + Intronic
1031919046 7:127588309-127588331 GGGGAGGCGGGGCCGAGAGCCGG + Intronic
1034441729 7:151089058-151089080 AGGGGGGAGGGAGGGACAGCAGG - Intronic
1035368222 7:158362024-158362046 CGGGATGAGTGACAGACAGACGG - Intronic
1035725853 8:1824344-1824366 GGGGAGCAGGGACTGGCAGCAGG + Intronic
1038760989 8:30384363-30384385 CGGGAGGAGGGGCCGGCGGCCGG - Intergenic
1048539907 8:135333164-135333186 CGTGAGGAGGGACTTACATCTGG + Intergenic
1048890810 8:138944673-138944695 CCAGAGGAGGGACTGACAACTGG + Intergenic
1049125940 8:140787928-140787950 CTGGAGGAGGGAGCAACTGCTGG - Intronic
1049654625 8:143792167-143792189 CAGGAGCAGGGACAGGCAGCAGG + Intronic
1057596451 9:96418882-96418904 CGGGTGGTGGGACCGAGGGCGGG - Intergenic
1059001655 9:110354943-110354965 CAGGAGGAGGGAAAGGCAGCAGG + Intergenic
1061534467 9:131239074-131239096 GGGGAGGAGGGCCAGACAGGAGG - Intergenic
1061897393 9:133655560-133655582 CGGGAGGAGGGGGCGGCAGCTGG + Intronic
1062568048 9:137171927-137171949 CAGGAGGAGGCACCTGCAGCAGG + Exonic
1062600229 9:137316065-137316087 CCGGGGGAGGGAACGAGAGCTGG - Intronic
1189160277 X:38803732-38803754 GGGGAAGAGGGGCCGGCAGCAGG - Exonic
1189389476 X:40563899-40563921 TGGGATGAGGCACCAACAGCTGG + Intergenic
1192141045 X:68647490-68647512 CGGCAGGAGGGCCGGACACCCGG + Intergenic
1197774610 X:130110968-130110990 CGGAGGGAGGGACCGACGGGAGG + Intergenic