ID: 1076781475

View in Genome Browser
Species Human (GRCh38)
Location 10:132727123-132727145
Sequence ATGGCGGGTGACAGTGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 167}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076781467_1076781475 -5 Left 1076781467 10:132727105-132727127 CCCTCAAGGTTGCCCCGGATGGC 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1076781475 10:132727123-132727145 ATGGCGGGTGACAGTGCTGTGGG 0: 1
1: 0
2: 0
3: 15
4: 167
1076781460_1076781475 21 Left 1076781460 10:132727079-132727101 CCGTGTTGGAATCCGGGGTGCGC 0: 1
1: 0
2: 0
3: 2
4: 59
Right 1076781475 10:132727123-132727145 ATGGCGGGTGACAGTGCTGTGGG 0: 1
1: 0
2: 0
3: 15
4: 167
1076781468_1076781475 -6 Left 1076781468 10:132727106-132727128 CCTCAAGGTTGCCCCGGATGGCG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1076781475 10:132727123-132727145 ATGGCGGGTGACAGTGCTGTGGG 0: 1
1: 0
2: 0
3: 15
4: 167
1076781463_1076781475 9 Left 1076781463 10:132727091-132727113 CCGGGGTGCGCGGGCCCTCAAGG 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1076781475 10:132727123-132727145 ATGGCGGGTGACAGTGCTGTGGG 0: 1
1: 0
2: 0
3: 15
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076781475 Original CRISPR ATGGCGGGTGACAGTGCTGT GGG Intronic
901513604 1:9730745-9730767 ATGCCAGGTGACGGGGCTGTGGG - Intronic
902463371 1:16597334-16597356 ATGGCCTGTGACAGAGCTCTGGG + Intronic
903158147 1:21463367-21463389 ATGGCCTGTGACAGAGCTCTGGG - Intronic
904624795 1:31796407-31796429 ATGGGGTGGGACAGTGCTGCTGG - Intronic
906680071 1:47720285-47720307 ATGGGGAGTGACAGGGCTGGGGG + Intergenic
907381023 1:54088995-54089017 ATTCCGGGAGACAGTGTTGTAGG + Intronic
909099676 1:71334622-71334644 GTGTCTAGTGACAGTGCTGTGGG - Intergenic
910004360 1:82377903-82377925 ATAGCTGTTTACAGTGCTGTTGG - Intergenic
912654362 1:111472368-111472390 ATGGAGGGAGAAAGGGCTGTGGG - Intergenic
914212809 1:145596335-145596357 ATGGCCTGTGACAGAGCTCTGGG + Intergenic
914996332 1:152546268-152546290 AGGGCAGGTGGCTGTGCTGTGGG - Intronic
915068344 1:153244660-153244682 ATGGTGGGTGATAGTGGTGTTGG + Intergenic
915300517 1:154948810-154948832 AAGGGGGGTGTCAGTGGTGTGGG - Intronic
916374374 1:164136236-164136258 ATGGCAGTTGTCAGGGCTGTGGG + Intergenic
916738515 1:167629156-167629178 TGGGCGGGTGAGAATGCTGTGGG + Intergenic
919465155 1:197916882-197916904 ATTTCGGGTGACAGTCCTGCAGG + Intronic
922697757 1:227740132-227740154 ATGGTTGGTGACAGTGCCTTAGG + Intronic
924045341 1:240024020-240024042 ATGGCTGATGTCAGTGCTGTTGG + Intronic
924553492 1:245099431-245099453 AGGGCTGGTGGCTGTGCTGTTGG - Intronic
1063947554 10:11192275-11192297 CTGGAGGGAGGCAGTGCTGTGGG + Intronic
1067089457 10:43259189-43259211 ATGCAGTGTGGCAGTGCTGTGGG + Intronic
1069378855 10:67821760-67821782 ATGCTGGGTGCCATTGCTGTAGG - Intronic
1069616007 10:69806474-69806496 ATGGCGGGAGCCAGCTCTGTGGG + Intronic
1073842477 10:107513811-107513833 ATGGCAGGTGACAAGGCTGATGG - Intergenic
1075723376 10:124599837-124599859 ATGGGGGCTGACAGTGCCATGGG - Intronic
1076394513 10:130129058-130129080 ACGGTGGGTGACAGGGCTGGGGG + Intergenic
1076781475 10:132727123-132727145 ATGGCGGGTGACAGTGCTGTGGG + Intronic
1076831515 10:132996635-132996657 ATGGACGGTGACAGAGCTGAGGG - Intergenic
1077240607 11:1508550-1508572 ATGGCGGGTGGCTTTGCTGAGGG - Intergenic
1077305152 11:1865636-1865658 TGAGCGGGTGACAGTGCAGTCGG - Intronic
1078508601 11:11969192-11969214 ATGGCAGGTCACAGTGCCCTCGG - Intronic
1078706268 11:13746997-13747019 ATGAGGGGTGACAATGATGTAGG + Intergenic
1081439315 11:43063027-43063049 ATAGCTGGTGACAGAGTTGTGGG - Intergenic
1083756950 11:64796932-64796954 GTGGTGGGTGGCAGGGCTGTGGG + Intronic
1084651971 11:70494816-70494838 ATGAAGGGAGAGAGTGCTGTGGG - Intronic
1085299734 11:75450959-75450981 AGGGCGGCCGGCAGTGCTGTGGG - Intronic
1086766165 11:90698161-90698183 ATGCTGGGTGATAGTGCTGCTGG + Intergenic
1091791992 12:3277253-3277275 ATGCCGGGTGAAAGTGCAGGTGG - Intronic
1092895518 12:13006731-13006753 ATGCCAGCTCACAGTGCTGTCGG + Intergenic
1094201378 12:27797907-27797929 CTGGCGGGTGACGGTGTTGTAGG - Exonic
1094339885 12:29399391-29399413 ATGGCTGAAGACAATGCTGTAGG + Intergenic
1096469698 12:51868593-51868615 ATGTCTGATGACAGTGCTGGGGG - Intergenic
1097668243 12:62506019-62506041 ATGGTTGGTGATAGTGCTGGAGG + Intronic
1100816473 12:98391635-98391657 TTGGGGGGTGACAGTGCTCCTGG + Intergenic
1102383482 12:112486807-112486829 ATGGCCAATGGCAGTGCTGTAGG - Intronic
1106564050 13:30870399-30870421 AGGGCTGGAGTCAGTGCTGTGGG + Intergenic
1107132166 13:36908232-36908254 ATGGCATGTAACATTGCTGTTGG - Intronic
1109515522 13:63438963-63438985 CTGGCTGGGGACAGTGCTGCTGG + Intergenic
1112870821 13:103968649-103968671 ATGGCAGGGGTCACTGCTGTTGG + Intergenic
1113641865 13:111963332-111963354 ATCAAGGGGGACAGTGCTGTGGG + Intergenic
1113768550 13:112894933-112894955 GTGGCTGGGGACAGTGCTGGAGG + Intronic
1115874808 14:37848504-37848526 AGAGAAGGTGACAGTGCTGTGGG - Intronic
1118819203 14:69334127-69334149 AAGGCAGGTCACAGTGCTGGTGG + Intronic
1121512612 14:94523412-94523434 ACTGCTGGTGACAGTGCTGAGGG - Intergenic
1122783083 14:104151929-104151951 ATGGACGGTGAGAGTGCTGGTGG + Intronic
1123000379 14:105290809-105290831 AGGGAGGGTGACTGTGGTGTTGG - Intronic
1123681530 15:22767737-22767759 ATGGCGGCTTACACTTCTGTAGG + Intergenic
1124050946 15:26197206-26197228 AGGGCTGGTGACAGGGCAGTGGG + Intergenic
1124333745 15:28842194-28842216 ATGGCGGCTTACACTTCTGTAGG + Intergenic
1125353463 15:38791602-38791624 ATGGCAGATGAGAGTGCTGGAGG + Intergenic
1132374331 15:101318811-101318833 ATGGCGTGTGACGGGGCTGTCGG + Intronic
1133702837 16:8325307-8325329 AGAGGTGGTGACAGTGCTGTAGG - Intergenic
1134743144 16:16566285-16566307 ATGGTGGTTGCCAGGGCTGTGGG - Intergenic
1134924416 16:18146175-18146197 ATGGTGGTTGCCAGGGCTGTGGG + Intergenic
1136568724 16:31084577-31084599 ATGGTGTGTACCAGTGCTGTGGG - Exonic
1144642007 17:16942824-16942846 ATGTCAGGTGACTGTGCTCTGGG - Intronic
1145207854 17:20994275-20994297 ATGTTGGGTGACCGTGCTCTGGG + Intergenic
1150596434 17:66610038-66610060 ATGGTGGGGGGCAGTGTTGTGGG - Intronic
1151534141 17:74729262-74729284 CTGGTGGGTGACAGTGGTGTGGG + Intronic
1151850487 17:76686940-76686962 GAGGCTGGTGACAGTGCTGGGGG + Intronic
1151886606 17:76926503-76926525 CTGGCTGGTGACAGTGCTCGTGG + Intronic
1155514296 18:26608594-26608616 CTGGGGGGTGACAGTGCAGAGGG - Intronic
1161140916 19:2647281-2647303 CTCGCTGGTGACAGTGCTTTGGG + Intronic
1161236196 19:3199375-3199397 CTCGCTGGTGACAGTGCTTTGGG - Intronic
1161885022 19:6987939-6987961 ATGGCGGGTGCCAGGGCCTTGGG + Intergenic
1163718765 19:18887921-18887943 ATGGGGGGTGCCAGGGCTGGGGG - Intronic
1164210418 19:23093460-23093482 ATGGTGGGTGCCCCTGCTGTGGG + Intronic
1166154478 19:40900594-40900616 ATGGTGTGTGACAGCGATGTAGG + Intergenic
1166230345 19:41422798-41422820 ACGGTGGCTGTCAGTGCTGTGGG - Intronic
1168722027 19:58559454-58559476 GTGGAGGGTTACAGTGGTGTAGG + Intergenic
1202679033 1_KI270711v1_random:34781-34803 ATGGCCTGTGACAGAGCTCTGGG + Intergenic
925058585 2:873881-873903 ATGCCGGGTGACAGGGCAGCAGG - Intergenic
925339884 2:3128797-3128819 ATGGTGGGTGCCAGGGCAGTGGG - Intergenic
925380686 2:3423513-3423535 ATGGCGGGTGCCGGGGCTGGGGG - Intronic
927922861 2:26986848-26986870 ATGGAGAGTGAGAGGGCTGTGGG + Intronic
930186724 2:48418878-48418900 ATAGCGGGTTAGAATGCTGTGGG - Intergenic
934609191 2:95722124-95722146 ATGGCAGGTGCCCGTGCTGCTGG + Intergenic
936542516 2:113363701-113363723 ATGGCGGGTGCCATTGCTGCTGG + Intergenic
937984041 2:127630624-127630646 ACGGCAGGTGACAGGGGTGTGGG + Intronic
938298125 2:130191202-130191224 AAGGCAGTTGACAGTGCTGAGGG + Intergenic
941331570 2:164183979-164184001 ATATGGGGTTACAGTGCTGTAGG - Intergenic
945955728 2:216084119-216084141 ATGGGGTATGACAGAGCTGTGGG - Intronic
948154273 2:235768787-235768809 TTAGCGGTTGACAGTGTTGTCGG + Intronic
948552861 2:238786275-238786297 ATTGCGGGTGCCAGGGCTGGGGG - Intergenic
1174307883 20:49627450-49627472 ATGGTGGGTGGCAGTCATGTAGG - Intergenic
1175263747 20:57690315-57690337 AGGGCGGGTGGCAGTGGTGGGGG - Intronic
1175575325 20:60056568-60056590 CTGTGGGGTGACAGAGCTGTGGG + Intronic
1180013693 21:45069166-45069188 TTGGCGGGTGATGGTGCTCTGGG - Intergenic
1183037430 22:35150798-35150820 ATGGCTGGGGACAGTGATGGTGG - Intergenic
951611461 3:24495527-24495549 AGGGTTGGTGACGGTGCTGTGGG + Intergenic
952897465 3:38087285-38087307 ATGGATGGTGTCAGTGCTGATGG - Intronic
952897467 3:38087304-38087326 ATGGATGGTGTCAGTGCTGATGG - Intronic
952897471 3:38087344-38087366 ATGGATGGTGTCAGTGCTGATGG - Intronic
952897473 3:38087363-38087385 ATGGATGGTGTCAGTGCTGATGG - Intronic
952897477 3:38087403-38087425 ATGGATGGTGTCAGTGCTGATGG - Intronic
952897483 3:38087462-38087484 ATGGATGGTGTCAGTGCTGATGG - Intronic
952897487 3:38087502-38087524 ATGGATGGTGTCAGTGCTGATGG - Intronic
952897489 3:38087521-38087543 ATGGATGGTGTCAGTGCTGATGG - Intronic
952897493 3:38087561-38087583 ATGGATGGTGTCAGTGCTGATGG - Intronic
952897497 3:38087601-38087623 ATGGATGGTGTCAGTGCTGATGG - Intronic
952900685 3:38109805-38109827 ATGGCAGGGGACAGGGCTGTAGG + Intronic
954146340 3:48636062-48636084 ATGGTGGGGGTCAGTGCTGTTGG + Intergenic
959043031 3:101441035-101441057 ATGGCGGGTGTGGGTGCTGATGG - Intronic
961049173 3:123732761-123732783 ATTGGGGGTGACATTTCTGTCGG + Intronic
963999016 3:151745630-151745652 ATTGCGGGAGACAGTTCTGGGGG + Exonic
964138373 3:153370020-153370042 AGGGCTGGTGGCAGTGCTGGCGG + Intergenic
965815851 3:172635944-172635966 ATTTCTGGTGACAGTGCTGGTGG - Exonic
968604430 4:1525578-1525600 ATGGTGGGTGCCAGGGGTGTGGG - Intergenic
969415307 4:7053936-7053958 AGGGTGGGTAACGGTGCTGTAGG + Intronic
970457375 4:16238429-16238451 ATGGCAAGTGATAGTACTGTGGG - Intergenic
972931884 4:44082237-44082259 TTGGAGGGTGTCAGTGCAGTGGG - Intergenic
974430138 4:61785984-61786006 AGGCCGGGTGACAGAGCTATTGG + Intronic
975170616 4:71228107-71228129 ATGAAGGGAGAAAGTGCTGTGGG - Intronic
975379421 4:73681221-73681243 ATATCTGGTGGCAGTGCTGTGGG + Intergenic
980134416 4:128846177-128846199 ATGGGGGGTGGCAGTGCTGAGGG - Intronic
981164940 4:141546543-141546565 ATGGAGGATGACAGGGCTTTTGG - Intergenic
982065558 4:151651475-151651497 ATGGAGGGTGACAGTGGCCTTGG + Intronic
982108602 4:152032841-152032863 ATGGAGAGTGACAGTGATGGGGG + Intergenic
983717625 4:170805028-170805050 ATGGCGGGCGACAGTGGTCTTGG - Intergenic
985540884 5:486933-486955 GTGGTGGGTGTCAGTGCGGTGGG - Intronic
985540902 5:487039-487061 GTGGTGGGTGTCAGTGCGGTGGG - Intronic
985540908 5:487069-487091 GTGGTGGGTGTCAGTGCGGTGGG - Intronic
985540920 5:487137-487159 GTGGTGGGTGTCAGTGCGGTGGG - Intronic
985540932 5:487205-487227 GTGGTGGGTGTCAGTGCGGTGGG - Intronic
985540944 5:487273-487295 GTGGTGGGTGTCAGTGCGGTGGG - Intronic
985540956 5:487341-487363 GTGGTGGGTGTCAGTGCGGTGGG - Intronic
985540968 5:487409-487431 GTGGTGGGTGTCAGTGCGGTGGG - Intronic
985540980 5:487477-487499 GTGGTGGGTGTCAGTGCGGTGGG - Intronic
985540989 5:487530-487552 GTGGTGGGTGTCAGTGCGGTGGG - Intronic
991009628 5:61869690-61869712 ATGGCAGATTCCAGTGCTGTAGG - Intergenic
999691058 5:154146194-154146216 AAGGCAGGGGACAGTGCCGTGGG - Intronic
1001525460 5:172425588-172425610 ATGACAGCTGACAGTGCTGCGGG + Intronic
1002170153 5:177370450-177370472 ATGGAGGGTGGAAGAGCTGTAGG - Intronic
1002323953 5:178393355-178393377 ATGGTGGGTGCCAGGGCTGTGGG + Intronic
1002843307 6:924268-924290 ATGGCAGGTCACAGTGGTCTTGG - Intergenic
1003869360 6:10390069-10390091 ATGGCGTGTGCCAGGGCTGATGG + Intergenic
1005002847 6:21260099-21260121 GTGGAGGGTGAGAGTGCTGTGGG + Intergenic
1006877787 6:37313684-37313706 ATGGCCAGTGACAGTGTTCTGGG - Intronic
1008906474 6:56682691-56682713 ATGTCTGGTGACAGCACTGTTGG - Intronic
1011277426 6:85643690-85643712 CTGGCGGGGCAGAGTGCTGTGGG + Intronic
1014098066 6:117482001-117482023 ATGGCGGGTAACAGGGGTGAGGG - Intronic
1015167778 6:130218053-130218075 ATGGGAGGTGATAGTGTTGTAGG + Intronic
1017509411 6:155100532-155100554 ATGGGAGGTGACAGTGATGGTGG - Intronic
1023669182 7:42558198-42558220 ATGGCTGGTGAAAGTGCTGCAGG - Intergenic
1026794991 7:73360234-73360256 TGGGCAGGTGACAGTGCTGGTGG - Intergenic
1028170226 7:87587299-87587321 ATGGCCAGTGACAGTTCTGGAGG - Intronic
1028346861 7:89793767-89793789 ATGGCGGGCCACAGTGGTCTTGG + Intergenic
1028401171 7:90427334-90427356 AGGGTGGGTGACAGTGCACTAGG - Intronic
1033705196 7:143879809-143879831 ATGGCTGGGGACAGTGCTACAGG - Intronic
1034929905 7:155153453-155153475 AGGGCTGGTGACAGTGTTGTAGG - Intergenic
1035370425 7:158376270-158376292 AGGACGTGTGACAGGGCTGTGGG - Intronic
1035370494 7:158376497-158376519 AGGACGTGTGACAGGGCTGTAGG - Intronic
1035370517 7:158376587-158376609 AGGACGTGTGACAGGGCTGTGGG - Intronic
1035370532 7:158376632-158376654 AGGACGTGTGACAGGGCTGTGGG - Intronic
1035370545 7:158376677-158376699 AGGACGTGTGACAGGGCTGTGGG - Intronic
1035370556 7:158376722-158376744 AGGACGTGTGACAGGGCTGTGGG - Intronic
1035370571 7:158376767-158376789 AGGACGTGTGACAGGGCTGTAGG - Intronic
1035370594 7:158376857-158376879 AGGACGTGTGACAGGGCTGTGGG - Intronic
1035370609 7:158376902-158376924 AGGACGTGTGACAGGGCTGTGGG - Intronic
1035370622 7:158376947-158376969 AGGACGTGTGACAGGGCTGTGGG - Intronic
1035370647 7:158377037-158377059 AGGACGTGTGACAGGGCTGTGGG - Intronic
1035370662 7:158377082-158377104 AGGACGTGTGACAGGGCTGTGGG - Intronic
1035370677 7:158377127-158377149 AGGACGTGTGACAGGGCTGTGGG - Intronic
1035370692 7:158377172-158377194 AGGACGTGTGACAGGGCTGTGGG - Intronic
1035370707 7:158377217-158377239 AGGACGTGTGACAGGGCTGTGGG - Intronic
1035413635 7:158666362-158666384 CCTGCAGGTGACAGTGCTGTTGG + Intronic
1037319243 8:17628566-17628588 TTGTCGGGTGACCGTGCTGTCGG + Exonic
1041310636 8:56512919-56512941 ATGGGCGGGGACAGTGCAGTGGG - Intergenic
1041545566 8:59038745-59038767 ATGGCAGAAGCCAGTGCTGTGGG - Intronic
1047787180 8:128164997-128165019 AGGCTGGGTGACAGTTCTGTAGG + Intergenic
1053168692 9:35862899-35862921 CTGGAGGGTGACAGTGATGAAGG - Intergenic
1194745410 X:97622611-97622633 ATTGCTGGTGACAGTGATGGGGG + Intergenic
1200384559 X:155877369-155877391 ATGGCAAGTGACAATGCTTTTGG + Intergenic